Collective identity Fusion in The difficult art of giving space(time) when you love someone (with a drude particle on their shoulder)
Booting up in Texas, rodeo style Joe...
EU urges countries to open borders to seasonal farm workers
Gosh Doggett,
Growing Our Economy
To grow our economy, we need to invest in our workforce, education, and job training. We need to fix our crumbling infrastructure, bringing it into the 21st century. We need to invest in health care, research and development, and bolster small businesses and local manufacturers.
The Evolution of City Size Distributions
∗Xavier GabaixMIT and NBERYannis M. IoannidesTufts UniversityAugust 7, 2003
Operations research
Flowchart
Data-flow analysis
Karen Parker
Data Flow Graph
Control-flow graph
Bohm diffusion
The diffusion of plasma across a magnetic field was conjectured to follow the Bohm diffusion
scaling as indicated from the early plasma experiments of very lossy
machines. This predicted that the rate of diffusion was linear with
temperature and inversely linear with the strength of the confining
magnetic field. (see CodingtheMatrix Lossy compression notes, much further in this research article)
Plasma transport through magnetic boudaries
Squeezed light plays a quantum drum
Outsourcing of Business Activities, Functions and Processes
Renormalization group
The Moon is made of green cheese
Year of the Rat in the shark tank with the Fat cat clinging to the curtains of the Oval OfficeFDIC Releases New Application Programming Interface and Modernized Version of BankFind
|
The Federal Deposit Insurance Corporation (FDIC) today announced the release of two bank data tools—the Application Programming Interface (API) for financial data and a modernized version of BankFind. These tools make it simpler for the public to connect with the FDIC by offering easy-to-use interfaces, interactive maps, a sleek mobile-ready experience and modern data delivery options.
The new API provides the public with over 1,100 Call Report data variables that financial institutions report quarterly. The API is available on FDIC.gov (banks.data.fdic.gov/bankfind-
Dividing Work through Modules
with
The Call Graph
for
Green hydrogen is the Goal with 25 GW needed @ rates of 10 trillion over the next 30 years statement made by THE UN, and noted driver of the utilities industry statement made by Goldman Sachs
Understanding Call Graphs
of duty...Spin (propaganda)
The parents of 545 children separated at the border still haven’t been found
Correlation Between Levels of Delusional Beliefs and Perfusion of the Hippocampus and an Associated Network in a Non–Help-Seeking Population
Mary Trump tell-all paints president as a ‘narcissist’ who is ‘lost to his own delusional spin’
More Than 70 West Point Cadets Accused Of Cheating In Academic Scandal
Spin (physics)
Spintronic Nanodevices for Bioinspired Computing
Green Hydrogen: Could It Be Key to a Carbon-Free Economy?
Green hydrogen, which uses renewable energy to produce hydrogen from water, is taking off around the globe. Its boosters say the fuel could play an important role in decarbonizing hard-to-electrify sectors of the economy, such as long-haul trucking, aviation, and heavy manufacturing.
By Jim Robbins • November 5, 2020
Peltier Effect
Thermoelectric generator
Thermoelectric effect
Thermoelectric cooling
Heat transfer physics
The Hype and Hope of Sahara Desert Green Hydrogen
Past supergrid plans have failed. Can a transcontinental hydrogen pipeline connect the energy futures of Europe and Africa?
At its most basic level, the word Sharia meant “path” or a “path to water,” and carried the meaning that there existed a path of right conduct that was pleasing to God.
Don’t blame Sharia for Islamic extremism – blame colonialism
9 | ٱلْجَبَّارُ | \ الجبّار
الجبار |
al-Jabbār/
al-Jabbār |
al-Jabbar
[al-Jabbaar] |
The Omnipotent/ Supreme Power/ Possessor of Having All Power/ Strong | 59:23 | D |
"booted out"
Both under the Constitution and under the principle of popular sovereignty outlined in the Declaration of Independence, Democrats would have every right to convene a traitor-free Congress.
Bootstrap is a free and open-source CSS framework directed at responsive, mobile-first front-end web development
A
machine learning application is the result of the repeated computation
of complex mathematical expressions. In TensorFlow, a computation is
described using the Data Flow Graph, where each node in the graph represents the instance of a mathematical operation (multiply
, add
, divide
, and so on), and each edge is a multi-dimensional data set (tensors) on which the operations are performed.
New Mexico Economic Development Department
The mission of the New Mexico Economic Development Department is to enhance and leverage a competitive environment to create jobs, develop the tax base and provide incentives for business development.
David Bohm, Quantum Mechanics and Enlightenment
The visionary physicist, whose ideas remain influential, sought spiritual as well as scientific illumination
By John Horgan
Spintronics
How to break up a programming project into tasks for other developers?
Helium-4
Proton–proton chain reaction
China Chang’e 5 probe has safely landed on the Moon [Updated]
The Asian nation currently has seven spacecraft operating near or on the Moon.
Eric Berger - 12/1/2020,
Stars
Fusion of Helium
Triple-alpha process
Anomalous Diffusion at Edge and Core of a Magnetized Cold Plasma
Mario J. Pinheiro
Department of Physics and Center for Plasma Physics,& Instituto Superior Tecnico, Av. Rovisco Pais, & 1049-001 Lisboa, Portugal∗(Dated: October 23, 2018)
3 Types of Diffusion
Anomalous diffusion
Diffusion current
Triple alpha nuclear fusion
C028/7904
Rights Managed
100.0 MB (4.2 MB compressed)
5264 x 6639 pixels
44.5 x 56.1 cm ⏐ 17.5 x 22.1 in (300dpi)
Alpha Fusion Chain
Drift current
Stellar nucleosynthesis
Plasma (physics)
Temperature
Steady state (chemistry)
Chemiluminescence
Thermoelectric effect
Seebeck effect
Quantum capacitance, also called chemical capacitance and electrochemical capacitance
High Mass Nucleosynthesis
Electromagnetic induction
Bias–variance tradeoff
Deep-Learning AI Has Officially Cracked Schrödinger's Equation, Says Study
From materials science to computer vision, the potential of this fundamental breakthrough is vast.
Quantum Computers Will Speed Up the Internet’s Most Important Algorithm
Fast Fourier transforms provide a sandbox for practical quantum computing
Triple threat: The first observation of three massive gauge bosons produced in proton-proton collisions
Steady state
Mechanism of sonoluminescence
Longshore drift
Longshore drift from longshore current is a geological process that consists of the transportation of sediments (clay, silt, pebbles, sand, shingle) along a coast parallel to the shoreline, which is dependent on oblique incoming wave direction. Oblique incoming wind squeezes water along the coast, and so generates a water current which moves parallel to the coast. Longshore drift is simply the sediment moved by the longshore current. This current and sediment movement occur within the surf zone.New Mexico the most coal-heavy state to pledge 100% carbon-free energy by 2045
The governor is expected to sign the bill quickly.
NMTAP offers free services to New
Mexicans with disabilities to help them get the assistive technology
(AT) services they need. It is a statewide program designed to increase
knowledge of, access to, and acquisition of assistive or adaptive
technology for anyone with any disability, anywhere in the state, of any
age.
Principles of sustainment
U.S. Army Doctrine Publication 4-0, published 31 July 2012 addresses sustainment principles. The eight principles of sustainment (logistics) are essential to maintaining combat power, enabling strategic and operational reach, and providing Army forces with endurance. While these principles are independent, they are also interrelated. The principles of logistics are the same as the principles of sustainment.The Berkeley Darfur Stove
www.potentialenergy.orgThe Three Stooges Baby Sitters Jitters E1311 Classic Slapstick Comedy
A Chip On Your Shoulder
Meaning:
Feasibility study
Fee-fi-fo-fum
Macroscopic Quantum-Type Potentials in Theoretical Systems Biology
Likert scale
Likert-Type Scale Response Anchors
PROCUREMENT TRANSFORMATION AT LANL
Career Family Classification System
managed service provider (MSP)
Managed services
Concern about stereotypes, and
Self-similarity
neuroscience
A Power Law Keeps the Brain’s Perceptions Balanced
Sommerfeld Expansion
Research shows human cells assembling into fractal-like clusters
In a finding that could shed light on tissue formation, wound healing and cancer spread, a new study shows that human cells follow the same rules as non-living particles to form fractal-like branching structures.
Lucent Public License
Pyroelectric fusion
Authors: Horowitz, C. J.
Journal: Astrophysical Journal, Part 1 (ISSN 0004-637X), vol. 367, Jan. 20, 1991, p. 288-295.
Bibliographic Code: 1991ApJ...367..288H
Metallic hydrogen
Sommerfeld expansion
Metallic hydrogen, once theory, becomes reality
"Holy Grail" Metallic Hydrogen Is Going to Change Everything
The substance has the potential to revolutionize everything from space travel to the energy grid.
Helium Recapture System Reclaims Hydrogen for Industry Use
NASA TechnologyWhy it’s so hard to make metallic hydrogen
Experimental challenges contributed to the controversy over claims of creating the elusive material
by Mitch Jacoby
Whitening a black box: how to interpret a ML model
Metallic Hydrogen
Metalloid
Periodic table territory
Electrons and “holes’’
Graph theory
Graph (discrete mathematics)
AI and Efficiency
Physics of semiconductors
Advanced Complexity Theory
P versus NP problem
Harvard Makes the Latest Claim for Creating Metallic Hydrogen
MICROSCOPIC DERIVATION OF LANDAU-GINZBURG FREE ENERGY FOR AN ION-ELECTRON TWO-COMPONENT PLASMA
Kuniyoshi EBINA, Makoto KABURAGI, in Strongly Coupled Plasma Physics, 1990
Silane plus molecular hydrogen as a possible pathway to metallic hydrogen
Perovskite (structure)
Perovskite Structure and Derivatives
SrTiO3 - Cubic Perovskites
1Crystallography and Chemistry of Perovskites Mats Johnsson a and Peter Lemmens bPerovskite structure also benefits batteries
Efficiently photo-charging lithium-ion battery by perovskite solar cell
Lithium lanthanum titanate perovskite as an anode for lithium ion batteries
Photo-Rechargeable Organo-Halide Perovskite Batteries
Piezoelectric microelectromechanical systems
Lattice energy
Hydrogen can be produced by the electrolysis of water (using an electric current to break water, H2O, into its component elements of hydrogen and oxygen). If this electric current is produced by a renewable source (e.g. Solar PV or a wind turbine), the clean hydrogen produced is known as green hydrogen.
Ph.D. Candidate in Chemistry, Colorado State University
Explore connected papers in a visual graph
Autonomous construction vehicles
Tactile sensor
Optimal Deployment of Vector Sensor Nodes in Underwater Acoustic Sensor Networks
A Proof About Where Symmetries Can’t Exist
Zimmer's conjecture is a statement in mathematics "which has to do with the circumstances under which geometric spaces exhibit certain kinds of symmetries."[1] It was named after the mathematician Robert Zimmer. The conjecture states that there can exist symmetries (specifically higher-rank lattices) in a higher dimension that cannot exist in lower dimensions.
In 2017, the conjecture was proven by Aaron Brown and Sebastián Hurtado-Salazar of the University of Chicago and David Fisher of Indiana University.[1][2][3]
Dyck paths
Some folks can be on a- Britisha celebration held for a man shortly before his wedding, attended by his male friends only.
- North Americanany party attended by men only.
Social clubs may be exempt from federal income taxation if they meet the requirements of section 501(c)(7) of the Internal Revenue Code.
A ( Deep) learning Club, soical perhaps someon has a 501(c)(7) as Austin meetups alread exits...
Deep Learning social club
The Series 7 exam, also known as the General Securities Representative Exam (GSRE), is a test for entry-level registered representatives.
A commodity pool operator is a salesman for a fund that invests in commodities futures. A CPO may work for a hedge fund or investment fund that takes positions in commodities. CPOs must register with the Commodities Futures Trading Commission.
Technical Assistance & Stakeholder Engagement.
The U.S. Department of Labor (DOL), in coordination with federal partners the U.S. Departments of Education (ED) and Health and Human Services (HHS), collaborated to provide information and resources for States, local areas, non-profits and other grantees, and other stakeholders to assist with WIOA enactment.
SSI say hi to SII
About The Social Innovation Initiative
The Social Innovation Initiative (SII) acts as UT-Austin’s hub on campus for innovation in social and environmental impact.
Joseph Campbell's Hero's Journey
Voice Dialogue: A Tool for Transformation
Smale's Problems, modulus and argument with Bridges' Transition Model
By David Vincent Bell HirschWiener Filtering
Adaptive-neighborhood filtering of images corrupted by signal-dependent noise
Rangaraj M. Rangayyan, Mihai Ciuc, and Farshad Faghih
Corrupted Signal
- Wiener
- 1. a frankfurter or similar sausage.
- 2.informala penis.
The Wiener filter
Happy Birthday, insert philosophical condom discussion, to you
Entropy (information theory)
Generalized Wiener filter
How Claude Shannon Invented the Future
Shannon–Hartley theorem
Hamiltonian path problem
Chemical equilibrium
Chemical vapor infiltration
SiC–SiC matrix composite
SiC 'em
Shepard's Citations
APD Sex Crimes Unit
Using Mathematica Packages
Node (computer science)
U.S. Bureau of Labor Statistics
Electrical resistance and conductance
Ionic compound
Helium compounds
Lithium
Lithium-ion battery
Crystal structure
In crystallography, crystal structure is a description of the ordered arrangement of atoms, ions or molecules in a crystalline material.[3] Ordered structures occur from the intrinsic nature of the constituent particles to form symmetric patterns that repeat along the principal directions of three-dimensional space in matter.
The smallest group of particles in the material that constitutes this repeating pattern is the unit cell of the structure. The unit cell completely reflects the symmetry and structure of the entire crystal, which is built up by repetitive translation of the unit cell along its principal axes. The translation vectors define the nodes of the Bravais lattice.
The lengths of the principal axes, or edges, of the unit cell and the angles between them are the lattice constants, also called lattice parameters or cell parameters. The symmetry properties of the crystal are described by the concept of space groups.[3] All possible symmetric arrangements of particles in three-dimensional space may be described by the 230 space groups.
The crystal structure and symmetry play a critical role in determining many physical properties, such as cleavage, electronic band structure, and optical transparency.
Nickel–hydrogen battery
Graphene
Metal-organic framework
Graphene applications as optical lenses
Nanoribbon
Ribbon theory
Time crystals enter the real world of condensed matter
Ribbon (mathematics)
Conductivity (electrolytic)
X-ray crystallography (XRC)
RIBBON LATTICES AND RIBBON FUNCTION IDENTITIES
MICHAEL CURRAN1, CALVIN YOST–WOLFF2, SYLVESTER ZHANG3, AND VALERIE ZHANG4
Crystal growth
Fermi's golden rule
Bloch's theorem
Proton–proton chain reaction
Becoming a Supplier
"I
yam what I yam and that's all what I yam," declared the existential
philosopher, Popeye the Sailor Man, I Am that I Am, Tat Tvam Asi (तत्
त्वम् असि) or ('ehyé 'asher 'ehyé) ,
אֶהְיֶה אֲשֶׁר אֶהְיֶה
Popeye - I Yam What I Yam & Dats What I Yam!
I am that I am is a common English translation of the Hebrew phrase אֶהְיֶה אֲשֶׁר אֶהְיֶה, ’ehyeh ’ăšer ’ehyeh ([ʔehˈje ʔaˈʃer ʔehˈje]) – also "I am who I am", "I will become what I choose to become",[citation needed] "I am what I am", "I will be what I will be", "I create what(ever) I create", or "I am the Existing One". [1] The traditional English translation within Judaism favors "I will be what I will be" because there is no present tense of the verb "to be" in the Hebrew language.Writings of Baha'u'llah, p. 52
It is clear and evident to thee that all the Prophets are the Temples of the Cause of God, Who have appeared clothed in divers attire. If thou wilt observe with discriminating eyes, thou wilt behold Them all abiding in the same tabernacle, soaring in the same heaven, seated upon the same throne, uttering the same speech, and proclaiming the same Faith. Such is the unity of those Essences of Being, those Luminaries of infinite and immeasurable splendor! Wherefore, should one of these Manifestations of Holiness proclaim saying: "I am the return of all the Prophets," He, verily, speaketh the truth. In like manner, in every subsequent Revelation, the return of the former Revelation is a fact, the truth of which is firmly established....
Speech
Shani (Sanskrit: शनि, Śani), or Śanaiśchara, refers to the planet Saturn, and is one of the nine heavenly objects known as Navagraha in Hindu astrology.[3] Shani is also a male deity in the Puranas, whose iconography consists of a handsome figure carrying a sword or danda (sceptre), and sitting on a crow.[3][4] He is the God of Justice in Hindu religion and delivers results to all, depending upon their thoughts, speech and deeds (karma[5][6]). He also signifies spiritual asceticism, penance, discipline and conscientious work. He married twice, first being Neela, goddess of sapphire, and Manda, a Gandharva maiden who cursed him due to a reason.[7][8]
Masá'íl. Questions. 11 December - 29 December or 12 December - 30
-Baha’u’llah, Prayers and Meditations
Gems of Divine Mysteries
Guru
Sharaf. Honor. 30 December - 17 January or 31 December - 18 January
Honor codes of the Bedouin
Svāhā
Planned and Open Procurement Opportunities
- NASA Center Small Business Contacts -
https://osbp.nasa.gov/
contacts.html - Tips on Doing Business with NASA -
https://osbp.nasa.gov/index.
html - NASA Acquisition Forecast -
https://www.hq.nasa.gov/
office/procurement/forecast/ - NASA Procurement –
https://www.nasa.gov/office/
procurement/doingbusiness - NASA Vendor Database -
https://osbp.nasa.gov/vendor_
database.html - OSBP Mobile App -
https://osbp.nasa.gov/osbp-
mobile.html (NASA’s Active Contract Listings, recurring buys) - Small Business Knowledge Portal webinar series -
https://osbp.nasa.gov/
knowledge-portal.html - NASA OSBP Outreach Events -
https://osbp.nasa.gov/
regional-outreach-events.html - NASA Mentor Protégé Program -
https://osbp.nasa.gov/mpp/
index.html - Federal Biz Opportunities (SAM Beta) – beta.SAM.gov
- NASA Partnerships -
https://www.nasa.gov/
partnerships.html - NASA Solutions for Enterprise-Wide Procurement (SEWP) - https://www.sewp.nasa.gov/
- NSAS Small Business Innovation Research/Small Business Technology Transfer (SBIR/STTR) - https://sbir.gsfc.nasa.gov/
- Top 20 Contractors -
https://osbp.nasa.gov/docs/
top_contractors2019_tagged.pdf
Semiclassical physics
Potassium channel
Potassium channels are the most widely distributed type of ion channel and are found in virtually all living organisms.Organic semiconductor
Organic semiconductors are solids whose building blocks are pi-bonded molecules or polymers made up by carbon and hydrogen atoms and – at times – heteroatoms such as nitrogen, sulfur and oxygen. They exist in form of molecular crystals or amorphous thin films. In general, they are electrical insulators, but become semiconducting when charges are either injected from appropriate electrodes, upon doping or by photoexcitation.
Organic semiconductor
Organic semiconductors are solids whose building blocks are pi-bonded molecules or polymers made up by carbon and hydrogen atoms and – at times – heteroatoms such as nitrogen, sulfur and oxygen. They exist in form of molecular crystals or amorphous thin films. In general, they are electrical insulators, but become semiconducting when charges are either injected from appropriate electrodes, upon doping or by photoexcitation.Arduino
Digital Pins
The pins on the Arduino can be configured as either inputs or outputs.Electronic structure of graphene and topological insulator nanowires
How to create nanowires only three atoms wide with an electron beam
by David SalisburyThe importance of the electron mean free path for superconducting radio-frequency cavities
J. T. Maniscalco, D. Gonnella, M. Liepe.
Mean free path
Niobium
Niobium, also known as columbium, is a chemical element with the symbol Nb (formerly Cb) and atomic number 41. Niobium is a light grey, crystalline, and ductile transition metal. Pure niobium has a Mohs hardness rating similar to that of pure titanium,[2] and it has similar ductility to iron. Niobium oxidizes in the earth's atmosphere very slowly, hence its application in jewelry as a hypoallergenic alternative to nickel. Niobium is often found in the minerals pyrochlore and columbite, hence the former name "columbium". Its name comes from Greek mythology, specifically Niobe, who was the daughter of Tantalus, the namesake of tantalum.
The name reflects the great similarity between the two elements in
their physical and chemical properties, making them difficult to
distinguish.[3]
Transition metal dichalcogenide (TMD or TMDC) monolayers are atomically thin semiconductors of the type MX2, with M a transition metal atom (Mo, W, etc.) and X a chalcogen atom (S, Se, or Te). One layer of M atoms is sandwiched between two layers of X atoms. They are part of the large family of so-called 2D materials, named so to emphasize their extraordinary thinness. For example, a MoS2 monolayer is only 6.5 Å thick. The key feature of these materials is the interaction of large atoms in the 2D structure as compared with first-row transition metal dichalcogenides, e.g., WTe2 exhibits anomalous giant magnetoresistance and superconductivity.[1]
The discovery of graphene shows how new physical properties emerge when a bulk crystal of macroscopic dimensions is thinned down to one atomic layer. Like graphite, TMD bulk crystals are formed of monolayers bound to each other by van-der-Waals attraction. TMD monolayers have properties that are distinctly different from those of the semimetal graphene:
- TMD monolayers MoS2, WS2, MoSe2, WSe2, MoTe2 have a direct band gap, and can be used in electronics as transistors and in optics as emitters and detectors.[2][3][4][5]
- The TMD monolayer crystal structure has no inversion center, which allows to access a new degree of freedom of charge carriers, namely the k-valley index, and to open up a new field of physics: valleytronics[6][7][8][9]
- The strong spin-orbit coupling in TMD monolayers leads to a spin-orbit splitting[10] of hundreds meV in the valence band and a few meV in the conduction band, which allows control of the electron spin by tuning the excitation laser photon energy and handedness.[11]
- 2D nature and high spin-orbit coupling of MoS2 can be used as promising material for spintronic application.[12]
The work on TMD monolayers is an emerging research and development field since the discovery of the direct bandgap[2] and the potential applications in electronics [13][3] and valley physics.[7][8][9] TMDs are often combined with other 2D materials like graphene and hexagonal boron nitride to make van der Waals heterostructures.
These heterostructures need to be optimized to be possibly used as
building blocks for many different devices such as transistors, solar cells, LEDs, photodetectors, fuel cells, photocatalytic
and sensing devices. Some of these devices are already used in everyday
life and can become smaller, cheaper and more efficient by using TMD
monolayers.[14][15] Others are still being developed and promise to have a huge impact on our technology.
Optoelectronics (or optronics) is the study and application of electronic devices and systems that source, detect and control light, usually considered a sub-field of photonics. In this context, light often includes invisible forms of radiation such as gamma rays, X-rays, ultraviolet and infrared, in addition to visible light. Optoelectronic devices are electrical-to-optical or optical-to-electrical transducers, or instruments that use such devices in their operation.[1] Electro-optics is often erroneously used as a synonym, but is a wider branch of physics that concerns all interactions between light and electric fields, whether or not they form part of an electronic device.
Optoelectronics is based on the quantum mechanical effects of light on electronic materials, especially semiconductors, sometimes in the presence of electric fields.[2]
- Photoelectric or photovoltaic effect, used in:
- photodiodes (including solar cells)
- phototransistors
- photomultipliers
- optoisolators
- integrated optical circuit (IOC) elements
- Photoconductivity, used in:
- Stimulated emission, used in:
- injection laser diodes
- quantum cascade lasers
- Lossev effect, or radiative recombination, used in:
- light-emitting diodes or LED
- OLEDs
- Photoemissivity, used in
Important applications[3] of optoelectronics include:
See also
- Interconnect bottleneck
- Liquid-crystal display
- Non-radiative lifetime
- OECC (OptoElectronics and Communications Conference)
Tree (data structure)
Branching factor
Bertha Swirles, Lady Jeffreys
Christmas (data) Trees
Link/cut tree
A Gentle Introduction to Graph Neural Networks (Basics, DeepWalk, and GraphSage)
These Five “Witness Trees” Were Present At Key Moments In America’s History
These still-standing trees are a living testament to our country’s tragic past
Relativistic quantum chemistry
Hartree-Fock method
List of quantum chemistry and solid-state physics software
Pointer Graph Networks
Petar Velickovi ˇ c, Lars Buesing, Matthew C. Overlan, ́
Razvan Pascanu, Oriol Vinyals and Charles Blundell
DeepMind
Pointer Networks for Deep Learning
Pipeline (computing)
Biodegradable plastic production in China outpacing ability to break down waste, says Greenpeace
China is currently the world’s largest producer of plastic waste
Plastic pipes are polluting drinking water systems after wildfires – it’s a risk in urban fires, too
SEMICLASSICALANDQUANTUM-ELECTRODYNAMICALAPPROACHES IN NONRELATIVISTIC RADIATION THEORY
P.W.MILONNI
AirForceWeaponsLaboratory, KirtlandAirForceBase, NewMexico
Born rule
Semiclassical approximations
In classical mechanics, motion of particles satisfies Newton’s laws, whereas in quantum mechanics, particles are described by the quantum wavefunction which satisfies the Schroedinger equation. Finally, in the semiclassical approximation to quantum mechanics, classical trajectories are used, but each trajectory is given a quantum phase so that quantum effects such as interference and tunneling can be described using only classical information. Since exact quantum calculations are extremely expensive, accurate semiclassical approximations are very useful.
Technology roadmap
Data fusion and machine learning to identify threat vectors for the Zika virus and classify vulnerability
SUPER RESOLUTION MICROSCOPY AND DEEP LEARNING IDENTIFY ZIKA VIRUS REORGANIZATION OF THE ENDOPLASMIC RETICULUM
Flying reindeer, flying drones...
A Machine Learning-Based algorithm for the assessment of clinical metabolomic fingerprints in Zika virus disease
A dynamic neural network model for predicting risk of Zika in real time
BMC Medicine volume 17, Article number: 171 (2019)
Infections@BDI Seminar: Modelling the population biology and transmission dynamics of river blindness: deterministic and stochastic approaches to inform control and elimination
Maria-Gloria Basáñez, Imperial College London
Monday, 16 December 2019,Series A, B, C Funding: How It Works
TPOC | Total Payment Obligation to the Claimant (legal) | |
TPOC | Temporary Private Operator Certificate (Canada) | |
TPOC | Technical Proof of Concept | |
TPOC | Technical/Training Point Of Contact | |
TPOC | Technical Point of Contact |
Virginia Department of Accounts
A commodity pool operator is a salesman for a fund that invests in commodities futures. A CPO may work for a hedge fund or investment fund that takes positions in commodities. CPOs must register with the Commodities Futures Trading Commission
How a salesman’s 141 year old legal “stickers” forever changed legal research.
Cardinality (data modeling)
Cantor showed that there’s a one-to-one correspondence between the elements of each of these infinite sets.
Commodity Pool Operator (CPO) Registration
A commodity pool operator (CPO) is an individual or organization that operates a commodity pool and solicits funds for that commodity pool. A commodity pool is an enterprise in which funds contributed by a number of persons are combined for the purpose of trading futures or options on futures, retail off-exchange forex contracts, or swaps, or to invest in another commodity pool.
Americans with Disabilities
Act of 1990
20 CFR § 685.110 - What definitions apply to this program?
Eligible migrant farmworker means an eligible seasonal farmworker as defined in WIOA sec. 167(i)(3) whose agricultural labor requires travel to a job siteA university denied Lex Frieden admission because he was disabled. Then he fought back.
Economic inflation and its effect on agriculture
Drought Sale
Inflation: One Big Difference Between Today and the 70’s and 80’s
By Brent Gloy
IRS: Drought-stricken farmers, ranchers have more time to replace livestock
Tom Vilsack is a corporate yes man and former lobbyist with a dismal record in his previous time as secretary. This is appalling
Tom Vilsack
Can China plant vegetables on the Moon?
Dark Storm on Neptune Reverses Direction, Possibly Shedding a Fragment
Argument
Why India’s Farmers Won’t Stop Protesting
Agriculture’s importance for the labor market cannot be underestimated—especially amid a historic pandemic.
Feeding the gods: Hundreds of skulls reveal massive scale of human sacrifice in Aztec capital
By Lizzie Wade
Atira (goddess)
Exploratory analysis and regression model helping fight Zika
The First Frontier for Medical AI Is the Pathology Lab
But before adopting startup PathAI’s tools, doctors must see if they are worth the cost
Using AI in the fight against river blindness
More than 21 million people in Africa are infected with the nematode Onchocerca volvulus, the cause of river blindness. Around one in ten of those affected goes blind. Parasitologists at the University Hospital Bonn are looking for new, more effective weapons against the insidious parasite.
Eye of a needle
Buffon's needle problem
In mathematics, Buffon's needle problem is a question first posed in the 18th century by Georges-Louis Leclerc, Comte de Buffon:[1]
- Suppose we have a floor made of parallel strips of wood, each the same width, and we drop a needle onto the floor. What is the probability that the needle will lie across a line between two strips?
The Math Behind Gerrymandering and Wasted Votes
Examples include the banyan and the sacred fig (Ficus religiosa) in Hinduism, Buddhism and Jainism, the tree of the knowledge of good and evil of Judaism and Christianity. In folk religion and folklore, trees are often said to be the homes of tree spirits. Germanic mythology as well as Celtic polytheism both appear to have involved cultic practice in sacred groves, especially grove of oak.[4] The term druid itself possibly derives from the Celtic word for oak. The Egyptian Book of the Dead mentions sycamores as part of the scenery where the soul of the deceased finds blissful repose.[5]
The presence of trees in myth sometimes occurs in connection to the concept of the sacred tree and the sacred grove. Trees are an attribute of the archetypical locus amoenus.[6]
Vættir
The vættir (Old Norse; singular vættr) are spirits in Norse mythology. The term can be used to refer to the full cosmos of supernatural beings, including the álfar (elves), dvergar (dwarves), jötnar (giants), and gods (the Æsir and Vanir). Vættir can also refer more specifically to landvættir (nature spirits), fjallvættir (mountain spirits), sjóvættir (sea spirits), skogvættir (forest spirits), vatnavættir (guardians of the specific waters), or húsvættir (house spirits).[1][2]Christmas tree
Never Underestimate the Intelligence of Trees
Plants communicate, nurture their seedlings, and get stressed.
Trees in mythology
List of tree deities
Norse version of Adam and Eve as descended from Ash and Elm trees as
Ask and Embla
Yule or Yuletide ("Yule time" or "Yule season") is a festival historically observed by the Germanic peoples. Scholars have connected the original celebrations of Yule to the Wild Hunt, the god Odin, and the pagan Anglo-Saxon Mōdraniht.
Later departing from its pagan roots, Yule underwent Christianised reformulation,[1] resulting in the term Christmastide. Many present-day Christmas customs and traditions such as the Yule log, Yule goat, Yule boar, Yule singing, and others stem from pagan Yule traditions. Terms with an etymological equivalent to Yule are still used in Nordic countries and Estonia to describe Christmas and other festivals occurring during the winter holiday season. Today, Yule is celebrated in Heathenry and other forms of Neopaganism, as well as in LaVeyan Satanism.
Jeremiah 10:2-3
2 Thus saith the Lord, Learn not the way of the heathen, and be not dismayed at the signs of heaven; for the heathen are dismayed at them.
3 For
the customs of the people are vain: for one cutteth a tree out of the
forest, the work of the hands of the workman, with the axe.
Precession
Precisionism, an artistic movement also known as Cubist Realism
Ubuntu 12.04 "Precise Pangolin", Canonical's sixteenth release of Ubuntu
- Accuracy and precision, measurement deviation from true value and its scatter
- Significant figures, the number of digits that carry real information about a measurement
- Precision and recall, in information retrieval: the percentage of relevant documents returned
- Precision (computer science), a measure of the detail in which a quantity is expressed
- Precision (statistics), a model parameter or a quantification of precision
BigQuery
Tin & Lead Alloy Names
Actor cast as long-suffering biblical character in online production meant to bring Republicans and Democrats together in Ohio
A large portion of the Moon’s surface—about 83% of it—will pass behind Earth’s outer shadow next week
Don’t miss photographing Jupiter and Saturn as they appear closer together since the Middle Ages
November 23, 2020
Conservative vector field
Matthew 26:51-52
47 Ear Idioms And Sayings (Meaning & Examples)
July 6, 2020 by Wes
mmm, mmm Good, Andy Warhol
Beautiful Soup (HTML parser)
Actionable plans to safeguard several highly endangered bat species
Aggravation, in law, is "any circumstance attending the commission of a crime or tort which increases its guilt or enormity or adds to its injurious consequences, but which is above and beyond the essential constituents of the crime or tort itself."A Novel Bat Coronavirus Closely Related to SARS-CoV-2 Contains Natural Insertions at the S1/S2 Cleavage Site of the Spike Protein
Animal echolocation
HMMM
(Harvey Mudd Miniature Machine)
Gravitational energy
Principles of sustainment
Electric potential
Logistics, CSS, Sustainment: Evolving Definitions of Support | ||
by Lieutenant Colonel Jeffrey C. BrlecicColumbia-class submarine |
A monolithic MEMS position sensor for closed-loop high-speed atomic force microscopy
N Hosseini1, A P Nievergelt1, J D Adams1, V T Stavrov2 and G E Fantner1
Marine Corps’ amphibious combat vehicle reaches full-rate production
Atomic Position
Atomic positions are called lattice points and the entire lattice is called the crystal structure.
Navy Leading Edge Sensors
Naval System MicroCircuits
In one Southern California city, flying drones with artificial intelligence are aiding investigations while presenting new civil rights questions.
Communications, Circuits, and Sensing-Systems (CCSS)
Leading Edge Acceleration Projects (LEAP) in Health Information Technology (Health IT)
Smart grid
The Smart Grid
Maybe you have heard of the Smart Grid on the news or from your energy provider. But not everyone knows what the grid is, let alone the Smart Grid. "The grid," refers to the electric grid, a network of transmission lines, substations, transformers and more that deliver electricity from the power plant to your home or business. It’s what you plug into when you flip on your light switch or power up your computer. Our current electric grid was built in the 1890s and improved upon as technology advanced through each decade. Today, it consists of more than 9,200 electric generating units with more than 1 million megawatts of generating capacity connected to more than 300,000 miles of transmission lines. Although the electric grid is considered an engineering marvel, we are stretching its patchwork nature to its capacity. To move forward, we need a new kind of electric grid, one that is built from the bottom up to handle the groundswell of digital and computerized equipment and technology dependent on it—and one that can automate and manage the increasing complexity and needs of electricity in the 21st Century.
MEP
Ancient Mud Reveals an Explanation for Sudden Collapse of the Mayan Empire
The empire took thousands of years to build and just 100 years to collapse.
In Aztec mythology, the Centzon Tōtōchtin (Nahuatl pronunciation: [sent͡son toːˈtoːt͡ʃtin] "four-hundred rabbits"; also Centzontōtōchtin) are a group of divine rabbits who meet for frequent drunken parties. They include Tepoztecatl, Texcatzonatl, Colhuatzincatl, Macuiltochtli ("five-rabbit"), and Ometochtli ("two-rabbit"). Their parents are Patecatl and Mayahuel[1] and they may be brothers of Ixtlilton.
References
Mayan mathematics
The word "Beh" operates as the root term for "Sacbe" it is a Mayan term for "road, pathway, or trail." Beh is spelled alternately as Be, bej, bey, be, bih, as well as "beel" in the possessive.[3]
It has many distinctions from English concepts of roads, pathways, or trails. Beh's metaphoric meanings are just as important if not more important than its literal meaning of "road." Ethnographers working the lowlands have noted that it means "more than the road you see with your eyes." The term Beh refers to "the road of life".[3]
In the Colonial times "Sacbe" was translated to calzada which is Spanish for "main road/Highway." The literal translation of Sacbe is "white road." This is used to refer to Mayan large constructed roads covered in a white (Sac) surfacing.[3]
Tzolkin Trecena Notes – 1 Lamat (Rabbit/Venus)
Day 248 of the 260 Day Tzolkin
Last Trecena of the 260 Day Tzolkin
Gregorian Date: January 29, 2010
Year Bearer: 11 Manik
Trecenas are thirteen-day periods in the Tzolkin. Each Trecena starts with
the Number 1, but with
a different Day Glyph. As a wave of the Thirteen
Heavens, the underlying energy is governed by
the First Day Glyph of the Trecena and influences all thirteen successive Day Glyphs.
Being aware
of the predominant energy of the First Day of the Trecena, we can align our intentions with that
energy and
allow our goals to manifest.
This Trecena starts with 1 Lamat (Rabbit/Venus) – Abundant,
Energetic, Artistic, Playful, Humorous,
Clever, Balancing Physical Pleasures
and Spiritual Divinity.
The 8-year cycle and 5 ‘petals’ of Venus
Down the rabbit hole is a metaphor for adventure into the unknown, from its use in Alice's Adventures in Wonderland.
Invisible Dance of Earth And Venus Forms a Stunning Pentagrammic Pattern in Space
And then a Nagi played a Magi a game of Snakes and Ladders in game theory for Python programers to help make Earth great again for Hannuka, Frosty the Snow man and the Easter Bunny and living wage and Elven rights were negotiated for the Elf union. - A group of 400 divine drunken rabbits theatrics to 'On the Road'.Aaron's rod refers to any of the staves carried by Moses's brother, Aaron, in the Torah. The Bible tells how, along with Moses's rod, Aaron's rod was endowed with miraculous power during the Plagues of Egypt that preceded the Exodus. There are two occasions where the Bible tells of the rod's power.
Rod of Asclepius
In Greek mythology, the Rod of Asclepius (Greek: Ράβδος του Ασκληπιού, Rábdos tou Asklipioú, sometimes also spelled Asklepios or Asclepius), also known as the Staff of Aesculapius and as the asklepian,[1] is a serpent-entwined rod wielded by the Greek god Asclepius, a deity associated with healing and medicine. The symbol has continued to be used in modern times, where it is associated with medicine and health care, yet frequently confused with the staff of the god Hermes, the caduceus. Theories have been proposed about the Greek origin of the symbol and its implications.Vasuki
Vāsuki is a serpent king in Hindu and Buddhist religion. He is described as having a gem called Nagamani on his head. Manasa, another naga, is his sister. Vāsuki is Shiva's snake. He is known in Chinese and Japanese mythology as being one of the "eight Great Dragon Kings" (八大龍王 pinyin: Bādà lóngwáng; Japanese: Hachidai Ryūō),[2] amongst Nanda (Nāgarāja), Upananda, Sāgara (Shakara), Takshaka, Balavan, Anavatapta and Utpala.Bats Play A Major Role
In Plant Protection
true, as well
A pneumonia outbreak associated with a new coronavirus of probable bat origin
Robin laid an egg
The Batmobile lost a wheel
And the Joker got away, hey
Smart Health and Biomedical Research in the Era of Artificial Intelligence and Advanced Data Science (SCH)
Welcome to the Smart and Connected Health (SCH) website! The goal of the Smart and Connected Health research program, jointly supported by the National Science Foundation (NSF) and the National Institutes of Health (NIH), is to accelerate the development and use of innovative approaches to support the much needed transformation of health and healthcare from reactive and hospital-centered to preventive, proactive, evidence-based, person-centered and focused on well-being rather than disease. This program seeks to develop next generation health care solutions and encourage existing and new research communities to focus on breakthrough ideas in a variety of areas of value to health, such as sensor technology, networking, information and machine learning technology, decision support systems, modeling of behavioral and cognitive processes, as well as system and process modeling.
Patent Analysis Using Machine Learning
Wed, Dec 9, 2020 from 10:00 AM to 6:00 PM (CST)
Streamlit Share And LIME Visualization
Web scraping is a tool, not a crime Web scraping is one of the most powerful tools journalists have to hold companies and governments accountable.
Technology Readiness Level
Technology Readiness Levels (TRL) are a type of measurement system used to assess the maturity level of a particular technology. Each technology project is evaluated against the parameters for each technology level and is then assigned a TRL rating based on the projects progress. There are nine technology readiness levels. TRL 1 is the lowest and TRL 9 is the highest.
8(a) Business Development program
The federal government's goal is to award at least five percent of all federal contracting dollars to small disadvantaged businesses each year.
SEED fund
TABA
Matplotlib
Text classification using K Nearest Neighbors (KNN)
Your Ultimate Guide For Finding Machine Learning Datasets
UC Irvine Machine Learning Repository
Article by Meiryum Ali
Serverless, highly scalable, and cost-effective multi-cloud data warehouse designed for business agility.
We’re making tools and resources available so that anyone can use technology to solve problems.
AI & Machine Learning
How AI, and specifically BERT, helps the patent industry
Center for AI and Patent Analysis
Department of Engineering & Public Policy
Mechanical Soup tutorial
A Text Classification Algorithm based on Feature Weighting
Han Yang1, a), Honggang Cui1 and Hao Tang
Presented by:
Rakshak Talwar
HOW TO EXPERIENCE AUSTIN'S BATS
Bat Watching 101
Researchers “Translate” Bat Talk. Turns Out, They Argue—A Lot
A machine learning algorithm helped decode the squeaks Egyptian fruit bats make in their roost, revealing that they “speak” to one another as individuals
Quantum device performs 2.6 billion years of computation in 4 minutes
Photons explore quantum maze faster than possible for any classical computer.
Chris Leewhat took you so long?
Types of artificial neural networks
SQLAlchemy
Artificial neural network
The Attention Mechanism & Encoder-Decoder Variants
CMSC 470 Marine Carpuat
Attention? Attention!
Jun 24, 2018 by Lilian WengLegal Technology Tips, Tricks, & Treats 2019
Attention Mechanism in Neural Networks
Recurrent neural network
Thermoelectric Seebeck Coefficient
Thermoelectric Seebeck-Coefficient & Resistivity
Transduction (machine learning)
Hanukkah 2020 will begin in the evening of
The burning bush is an object described by the Book of Exodus[3:1–4:17] as being located on Mount Horeb. According to the narrative, the bush was on fire, but was not consumed by the flames, hence the name.[1] In the biblical narrative, the burning bush is the location at which Moses was appointed by God to lead the Israelites out of Egypt and into Canaan.
plagues are described in chapters 7 through 11 of the book of Exodus
The, coming war on the hidden algorithms that trap people in poverty
A growing group of lawyers are uncovering, navigating, and fighting the automated systems that deny the poor housing, jobs, and basic services.
Trishula
American Gothic
Birth of the Fed
The secret expedition that formed America’s central bank
By Scott Freeman
Just before Thanksgiving in 1910, U.S. senator Nelson Aldrich of Rhode Island invited six members of America’s banking elite to a covert retreat on Jekyll Island. This was before the first transcontinental call (placed by the president of AT&T from a phone on Jekyll in 1915). It was before the internet and cable news. Secrets could be taken to the island and secrets would stay there.
Don't have a Cow, man! - Bart Simpson
Religion
Rick Perry signed the James Byrd Jr. Hate Crimes Act (“Byrd Act”) into law defining hate crimes as offenses “motivated by bias or prejudice.”
significance of cows in Indian society between sacredness and economy onto
‘Seditious abuse of the judicial process’: States reject Texas effort to overturn Biden’s election
Sedition
Indian Territory
Indignation
Texas AG Ken Paxton, Under FBI Investigation, Asks SCOTUS to Overturn the Election
The lawsuit, which seeks to invalidate millions of votes, makes more sense as an audition for a pardon than as a legal document.
Indignation
Understanding Anti-SLAPP laws
Accomplice
Prison Economics Help Drive Ariz. Immigration Law
Your boss is going to start using AI to monitor you—and labor laws aren’t ready
Our labor laws are weak enough as they are—and technology is constantly helping companies find ways around the ones that do exist to more closely monitor and analyze their workers.
Jeffrey M. Hirsch
Geneva Yeargan Rand Distinguished Professor of Law
Magi
Kingdom of Kush, Hindu Kush, Asuras (Ahuras) and Devas (Daevas)
Biblical Magi
The biblical Magi[a] (/ˈmeɪdʒaɪ/ or /ˈmædʒaɪ/;[1] singular: magus), also referred to as the (Three) Wise Men or (Three) Kings, were – in the Gospel of Matthew and Christian tradition – distinguished foreigners who visited Jesus after his birth, bearing gifts of gold, frankincense and myrrh. They are regular figures in traditional accounts of the nativity celebrations of Christmas and are an important part of Christian tradition.How a secret meeting on Jekyll Island led to the Fed
Why did God command Ezekiel to bake his bread with dung?
Dreidel
driven evidence ofSacred cow
Kali is the Hindu goddess (or Devi) of death, time, and doomsday and is often associated with sexuality and violence but is also considered a strong mother-figure and symbolic of motherly-love. Kali also known as Kālikā (Sanskrit: कालिका) or Shyāmā (Sanskrit: श्यामा), is a Hindu goddess. Kali is the chief of the Mahavidyas
Zoroastrian Jamsetjee JeeJeebhoy and the opium Astor Sassoons Cohong Kibbutz
By David Vincent Bell HirschDoctor Who
An eccentric yet compassionate extraterrestrial Time Lord zips through time and space to solve problems and battle injustice across the universe, traveling via the TARDIS (Time and Relative Dimensions in Space), which is his old and occasionally unreliable spaceship that resembles a blue police phone box (but changes its appearance depending on its surroundings) and is much, much larger inside than outside.-
See also
- Bad faith (existentialism)
- Masking (personality)
-
What are Jung's 4 major archetypes?The psychiatrist and psychotherapist Carl Gustav Jung proposed that everyone's personality contains elements of four major archetypes. These archetypes provide models for our behavior and influence the way we think and act. Jung labeled these archetypes the Self, the Persona, the Shadow and the Anima/Animus.
Nazis, Operation Condor, and Bush's Privatization Plan
by William F. Wertz,
According to the IRS Publication 557, in the Organization Reference Chart section, the following is an exact list of 501(c) organization types and their corresponding descriptions.[1][a]
- 501(c)(1) – Corporations Organized Under Act of Congress (including Federal Credit Unions[3] and National Farm Loan Associations[4])
- 501(c)(2) – Title-holding Corporations for Exempt Organizations[5]
- 501(c)(3) – Religious, Educational, Charitable, Scientific, Literary, Testing for Public Safety, to Foster National or International Amateur Sports Competition, or Prevention of Cruelty to Children or Animals Organizations
- 501(c)(4) – Civic Leagues, Social Welfare Organizations, and Local Associations of Employees
- 501(c)(5) – Labor, Agricultural and Horticultural Organizations
- 501(c)(6) – Business Leagues, Chambers of Commerce, Real Estate Boards, etc.
- 501(c)(7) – Social and Recreational Clubs
- 501(c)(8) – Fraternal Beneficiary Societies and Associations
- 501(c)(9) – Voluntary Employee Beneficiary Associations
- 501(c)(10) – Domestic Fraternal Societies and Associations
- 501(c)(11) – Teachers' Retirement Fund Associations
- 501(c)(12) – Benevolent Life Insurance Associations, Mutual Ditch or Irrigation Companies, Mutual or Cooperative Telephone Companies, etc.
- 501(c)(13) – Cemetery Companies
- 501(c)(14) – State-Chartered Credit Unions, Mutual Reserve Funds
- 501(c)(15) – Mutual Insurance Companies or Associations
- 501(c)(16) – Cooperative Organizations to Finance Crop Operations
- 501(c)(17) – Supplemental Unemployment Benefit Trusts
- 501(c)(18) – Employee Funded Pension Trust (created before June 25, 1959)
- 501(c)(19) – Post or Organization of Past or Present Members of the Armed Forces
- 501(c)(20) – Group Legal Services Plan Organizations[b]
- 501(c)(21) – Black Lung Benefit Trusts
- 501(c)(22) – Withdrawal Liability Payment Fund
- 501(c)(23) – Veterans Organizations[c]
- 501(c)(24) – Section 4049 ERISA Trusts[d]
- 501(c)(25) – Real Property Title-Holding Corporations or Trusts with Multiple Parents[8]
- 501(c)(26) – State-Sponsored Organization Providing Health Coverage for High-Risk Individuals
- 501(c)(27) – State-Sponsored Workers' Compensation Reinsurance Organization
- 501(c)(28) – National Railroad Retirement Investment Trust
- 501(c)(29) – Qualified Nonprofit Health Insurance Issuers
Eating crow is a colloquial idiom, used in some English-speaking countries, that means humiliation by admitting having been proven wrong after taking a strong position.
Why do Hindus worship cows?
Buddhism
10,000-year History of Marijuana use in the World
In 1930s New York, the Mayor Took on the Mafia by Banning Artichokes
Gangs and mafiosos have a long history with food crime
Here's even more evidence that plant protein is better for you than animal protein
Sorry, steak fans.
Piggybacking? Not with my pig propaganda vegan marketing lobby channel with kosher and gluten free menus for diabetics! Attention to those devils in the details with the server staff:Jonathan asks for a tax exemption for Judea
Reclaiming the Land (1 Maccabees 15:28–36): Hasmonean Discourse between Biblical Tradition and Seleucid Rhetoric
condensed matter physics
Universal Quantum Phenomenon Found in Strange Metals
Convolutional neural network
Mirror neuron
Mirror neurons and Quantum Consciousness
What We Know Currently about Mirror Neurons
The Mirror Neuron Revolution: Explaining What Makes Humans Social
Neuroscientist Marco Iacoboni discusses mirror neurons, autism and the potentially damaging effects of violent movies.
Harnessing Chaos in Recurrent Neural Networks
Americans with Disabilities Act of 1990
The Concept of the "Triune Brain"
"Mind-monkey" in English
Please Meet Your Monkey Mind
By Executive Director Heidi HannaGenetic studies reveal diversity of early human populations – and pin down when we left Africa
Research Associate in Statistical Genomics, University of Oxford
Miriam Cursed for Being Racist (Numbers 12): On Racism, Prejudice, and Other Things that make you Uncomfortable at Church
Racism in Our Holy Torah?
“The Consequences of Racism”
Hundredth monkey effect
Office of Business Opportunity
Disparity Study
Tensorflow
Neural machine translation with attention
Matthew 15:19, 20,
Ephesians 4:31, NIV:
1 Peter 2:1-3
Wherefore laying aside all malice, and all guile, and hypocrisies, and envies, and all evil speakings,
2 As newborn babes, desire the sincere milk of the word, that ye may grow thereby:
3 If so be ye have tasted that the Lord is gracious.
Del
Atom vibrations
Create and train a neural machine translation model with attention in TF2
A Beginner's Guide to Attention Mechanisms and Memory Networks
I cannot walk through the suburbs in the solitude of the night without thinking that the night pleases us because it suppresses idle details, much like our memory. - Jorge Luis BorgesAll Your Memories Are Stored by One Weird, Ancient Molecule We actually borrowed our ability to form memories from viruses.
We actually borrowed our ability to form memories from viruses.
Machine learning for the meta-analyses of microbial pathogens’ volatile signatures
- Susana I. C. J. Palma,
- Ana P. Traguedo,
- Ana R. Porteira,
- Maria J. Frias,
- Hugo Gamboa &
- Ana C. A. Roque
Scientific Reports volume 8, Article number: 3360 (2018)
Language model
n-gram
Language Modeling
(Course notes for NLP by Michael Collins, Columbia University)
Language Modeling
Introduction to N-grams
Ezekiel 34
The good shepherd
Numerosity adaptation effect
The numerosity adaptation effect is a perceptual phenomenon in numerical cognition which demonstrates non-symbolic numerical intuition and exemplifies how numerical percepts can impose themselves upon the human brain automatically. This effect was first described in 2008.Wireless sensor network
Special unitary group
In mathematics, the special unitary group of degree n, denoted SU(n), is the Lie group of n × n unitary matrices with determinant 1.See also
Soliton
GCSE is the qualification taken by 15 and 16 year olds to mark their graduation from the Key Stage 4 phase of secondary education in England, Northern Ireland and Wales.
Changes in energy stores
AQA
By David Vincent Bell Hirsch
There are seven books in the Catholic Bible — Baruch, Judith, 1 and 2 Maccabees, Sirach, Tobit and Wisdom — that are not included in the Protestant version of the Old Testament.
Who is the son of Sirach?Joshua ben Sirach, or, according to the Greek text "Jesus
the son of Sirach of Jerusalem", was a Jewish scribe who had been
living in Jerusalem, and may have authored the work in Alexandria, Egypt
ca. 180–175 BCE, where he is thought to have established a school.Pink Floyd Drunken Elephant party of five.
There are seven books in the Catholic Bible — Baruch, Judith, 1 and 2 Maccabees, Sirach, Tobit and Wisdom — that are not included in the Protestant version of the Old Testament.
Drones for Disaster Response: NASA STEReO Project Kicks Off
bats, birds, zoonoses research with microbial learning, machine learning modeling considerationsBy Reuters Staff
Avian influenza
By SUZAN FRASERZoonotic Diseases: Disease Transmitted from Animals to Humans
A zoonosis (zoonotic disease or zoonoses -plural) is an infectious disease that is transmitted between species from animals to humans (or from humans to animals).
Zoonosis
After
a chance encounter in Brazil, Johann Zillinger became one of the
world’s most prolific wildlife smugglers. Three decades and two prison
stints later, he says he has gone straight.
No disruption to Christmas supplies expected after outbreak at Northallerton site
A Framework for Effective Application of Machine Learning to Microbiome-Based Classification Problems
Zoonoses
Key facts
- A zoonosis is any disease or infection that is naturally transmissible from vertebrate animals to humans
- There are over 200 known types of zoonoses
- Zoonoses comprise a large percentage of new and existing diseases in humans
- Some zoonoses, such as rabies, are 100% preventable through vaccination and other methods
What Is a Black Swan?
A black swan is an unpredictable event that is beyond what is normally expected of a situation and has potentially severe consequences. Black swan events are characterized by their extreme rarity, severe impact, and the widespread insistence they were obvious in hindsight.
Spate of swan deaths investigated for avian flu connection
Outbreaks of H5N8, which has been in evidence among wild bird populations in Europe and have been confirmed in geese and swans in Gloucestershire, Devon and Dorset.
Joe MiddletonBlack Swan (2010)
PyData
Movidius
Nvidia Jetson
ARM Cortex-M
Hopf fibration Chaos Theory Total Order Free Action
pygrametl - ETL programming in Python
Jython
Building a real-time embeddings similarity matching system
smart
Piccolo
Transformers
more than meets the eyeParallelepiped
If you got stuck with Dimension problem, this is for you
A graphics processing unit (GPU) is a specialized, electronic circuit designed to rapidly manipulate and alter memory to accelerate the creation of images in a frame buffer intended for output to a display device. GPUs are used in embedded systems, mobile phones, personal computers, workstations, and game consoles. Modern GPUs are very efficient at manipulating computer graphics and image processing. Their highly parallel structure makes them more efficient than general-purpose central processing units (CPUs) for algorithms that process large blocks of data in parallel. In a personal computer, a GPU can be present on a video card or embedded on the motherboard. In certain CPUs, they are embedded on the CPU die.[1]
In the 1970s, the term "GPU" originally stood for graphics processor unit and described a programmable processing unit independently working from the CPU and responsible for graphics manipulation and output.[2][3] Later, in 1994, Sony used the term (now standing for graphics processing unit) in reference to the PlayStation console's Toshiba-designed Sony GPU in 1994.[4] The term was popularized by Nvidia in 1999, who marketed the GeForce 256 as "the world's first GPU".[5] It was presented as a "single-chip processor with integrated transform, lighting, triangle setup/clipping, and rendering engines".[6] Rival ATI Technologies coined the term "visual processing unit" or VPU with the release of the Radeon 9700 in 2002.[7]
A New Mathematical Discovery from Neutrino Physics
Zero Energy Buildings
Responsibility and Freedom
The Anglo-Persian Oil Company (APOC) was a British company founded in 1908 following the discovery of a large oil field in Masjed Soleiman, Iran. The British government purchased 51% of the company in 1914,[1] gaining a controlling number of shares, effectively nationalizing the company. It was the first company to extract petroleum from Iran. In 1935 APOC was renamed the Anglo-Iranian Oil Company (AIOC) when Reza Shah Pahlavi formally asked foreign countries to refer to Persia by its endonym Iran.
In 1954, it was renamed again to the British Petroleum Company (BP), one of the antecedents of the modern BP public limited company. The government of Mohammad Mosaddegh nationalized the company's local infrastructure assets and gave the new company the name National Iranian Oil Company. The British waged a trade war with Iran rather than pay Iran's new prices (the arrangement since 1901 had been that Iran got only 16% of the profits) and, with the United States' CIA, arranged a military coup to depose Mosaddegh and install a regime more favorable to the UK.
The 1953 Iranian coup d'état, known in Iran as the 28 Mordad coup d'état (Persian: کودتای ۲۸ مرداد), was the overthrow of the democratically elected Prime Minister Mohammad Mosaddegh in favour of strengthening the monarchical rule of the Shah, Mohammad Reza Pahlavi on 19 August 1953,[5] orchestrated by the United States (under the name TPAJAX Project[6] or "Operation Ajax") and the United Kingdom (under the name "Operation Boot"), and carried out by the Iranian military.
Operation Earnest Will (24 July 1987 – 26 September 1988) was the American military protection of Kuwaiti-owned tankers from Iranian attacks in 1987 and 1988, three years into the Tanker War phase of the Iran–Iraq War. It was the largest naval convoy operation since World War II.
Why did the United States go to war in Iraq in 2003?
A look at the rationales for going to war in Iraq, from WMD and terrorism to democracy in the Middle East. Americans were told by President Bush and his administration that the U.S. was going to war with Iraq because of the imminent threat of Saddam's weapons of mass destruction and ties to terrorism.
Arbusto Energy was an oil and gas exploration firm started in 1977 by former US President George W. Bush. In 1984, the company merged with Spectrum 7 Energy Corp. In 1986, a rapid fall in oil prices made investment in oil exploration unattractive, and put the company in financial difficulties. Spectrum 7 began looking for partners or purchasers, and in September of that year it was acquired by Harken Energy through a stock swap, with Bush joining the Harken board of directors.
From 1981-1986 the chief financial officer of Arbusto Energy was Mike Conaway. Conaway currently is the U.S. Representative for Texas's 11th congressional district. Notice Texas 11th congressional district, March 4, 1883 – January 3, 2005 was a Democratic Party, until CFO of Arbustor Energy, Mike Conaway a Republican business associate of George Bush, was ushered into a Republican Party run, Texas's 11th congressional district for the first time in the history of the district. How may this be significant for election rigging v. oil rigging?
Arbusto and James Bath
A Mysterious Mover of Money and Planes
By Jonathan Beaty
One of the early investors in Arbusto was Houston businessman James R. Bath. Bath and Bush became acquainted when both men were serving as reserve pilots in the Texas Air Guard in the early 1970s, and according to journalist Craig Unger, Bath invested $50,000 in Arbusto.
At the time of the investment, Bath was a representative for Saudi businessman Salem bin Laden, the oldest son of Mohammed bin Laden, founder of the Saudi Binladin Group, the largest old construction company in Saudi Arabia. Bath's business partner Charles White later became involved in a legal dispute with Bath, during which he claimed that Bath had actually invested in the company on behalf of bin Laden and other Saudi businessmen. Both Bath and Bush have denied this, and according to journalist Craig Unger, who examined the relationship between the Bushes and Saudi financiers in his 2004 book House of Bush, House of Saud, and journalist Steve Coll, whose book The Bin Ladens examines the family's history, there is no evidence to support the claim.
fromSolar v Coal, Montreux Convention, Crude Tanker War trader with Bridges transition Smale's solutions
The Psychopathic CEO
The Holocaust and the Bush family fortune
By
Bill Van Auken
5 December 2018
One in five CEOs are psychopaths, new study finds
Proportion of psychopath corporate executives 'similar to prison population'
6 Signs You’re in a Toxic Relationship
Dakota Access oil pipeline users downplay need for line to investors
Washington Post Staff Writers
Friday, July 30, 1999
The US Military and Oil
The US military uses more oil than any other institution in the world—but it’s also a leader in clean vehicle technology.
Published Jun 1, 2014 Updated Jun 30, 2014
64 Years Later, CIA Finally Releases Details of Iranian Coup
New documents reveal how the CIA attempted to call off the failing coup — only to be salvaged at the last minute by an insubordinate spy.
For Faust sake, In economics, Gresham's law is a monetary principle stating that "bad money drives out good".
Operation Condor
Operation Condor, which took place in the context of the Cold War, had the tacit approval and material support of the United States.[clarification needed] In 1968, U.S. General Robert W. Porter stated that "in order to facilitate the coordinated employment of internal security forces within and among Latin American countries, we are ... endeavoring to foster inter-service and regional cooperation by assisting in the organization of integrated command and control centers; the establishment of common operating procedures; and the conduct of joint and combined training exercises."[16] Condor was part of this effort.[17]
According to American historian J. Patrice McSherry, based on formerly secret CIA documents from 1976, in the 1960s and early 1970s plans were developed among international security officials at the US Army School of the Americas and the Conference of American Armies to deal with perceived threats in South America from political dissidents. A declassified CIA document dated 23 June 1976, explains that "in early 1974, security officials from Argentina, Chile, Uruguay, Paraguay, and Bolivia met in Buenos Aires to prepare coordinated actions against subversive targets."
Instead of putting the SS monster on trial, the US recruited him as a spy – a move which backfired when he joined forces with South American drug lords
‘American Made’ sheds light on shady Arkansas airfield deals
The Drug Connection
Barbie attained Bolivian citizenship under his assumed name in 1957 and once again benefitted from America’s rabid anti-communist stance. The United States was worried about the rise of communism in South America, so its government was happy to finance secret deals and covert operations to support right-leaning governments in the region. The growing cocaine industry played a pivotal role, and once again, Barbie assisted the Americans in their operations.
Barbie quickly made friends with high ranking members of the Bolivian army...
Armour of God II: Operation Condor (Chinese: 飛鷹計劃; also known as Operation Condor in the United States and as Superfly in the Philippines) is a 1991 Hong Kong action-comedy film written and directed by Jackie Chan, who also starred in the film. It is the sequel to 1986's Armour of God.
The Panama Papers: Exposing the Rogue Offshore Finance Industry
A giant leak of more than 11.5 million financial and legal records exposes a system that enables crime, corruption and wrongdoing, hidden by secretive offshore companies.
A giant leak of more than 11.5 million financial and legal records exposes a system that enables crime, corruption and wrongdoing, hidden by secretive offshore companies.
About the Panama Papers
The Armor of God
10 Finally, be strong in the Lord and in his mighty power. 11 Put on the full armor of God, so that you can take your stand against the devil’s schemes. 12 For our struggle is not against flesh and blood, but against the rulers, against the authorities, against the powers of this dark world and against the spiritual forces of evil in the heavenly realms. 13 Therefore put on the full armor of God, so that when the day of evil comes, you may be able to stand your ground, and after you have done everything, to stand. 14 Stand firm then, with the belt of truth buckled around your waist, with the breastplate of righteousness in place, 15 and with your feet fitted with the readiness that comes from the gospel of peace. 16 In addition to all this, take up the shield of faith, with which you can extinguish all the flaming arrows of the evil one. 17 Take the helmet of salvation and the sword of the Spirit, which is the word of God.
18 And pray in the Spirit on all occasions with all kinds of prayers and requests. With this in mind, be alert and always keep on praying for all the Lord’s people.
Agreement (linguistics)
Theoretical Machine Learning
Creating an amazing Conversational AI doesn’t have to be hard, and it certainly doesn’t need to take months! Transfer Learning is the way.
In information technology, lossy compression or irreversible compression is the class of data encoding methods that uses inexact approximations and partial data discarding to represent the content. These techniques are used to reduce data size for storing, handling, and transmitting content. The different versions of the photo of the cat to the right show how higher degrees of approximation create coarser images as more details are removed. This is opposed to lossless data compression (reversible data compression) which does not degrade the data. The amount of data reduction possible using lossy compression is much higher than through lossless techniques.
Well-designed lossy compression technology often reduces file sizes significantly before degradation is noticed by the end-user. Even when noticeable by the user, further data reduction may be desirable (e.g., for real-time communication, to reduce transmission times, or to reduce storage needs). The most widely used lossy compression algorithm is the discrete cosine transform (DCT), first published by Nasir Ahmed, T. Natarajan and K. R. Rao in 1974. Recently, a new family of sinusoidal-hyperbolic transform functions, which have comparable properties and performance with DCT, have been proposed for lossy compression.[1]
Lossy compression is most commonly used to compress multimedia data (audio, video, and images), especially in applications such as streaming media and internet telephony. By contrast, lossless compression is typically required for text and data files, such as bank records and text articles. It can be advantageous to make a master lossless file which can then be used to produce additional copies from. This allows one to avoid basing new compressed copies off of a lossy source file, which would yield additional artifacts and further unnecessary information loss.
Fibonacci Numbers and the Golden Section
In control engineering, a discrete event dynamic system (DEDS) is a discrete-state, event-driven system of which the state evolution depends entirely on the occurrence of asynchronous discrete events over time. Although similar to continuous-variable dynamic systems (CVDS), DEDS consists solely of discrete state spaces and event-driven state transition mechanisms.
Topics in DEDS include:
- Automata theory
- Supervisory control theory
- Petri net theory
- Discrete event system specification
- Boolean differential calculus
- Markov chain
- Queueing theory
- Discrete event simulation
- Concurrent estimation
References
- "IEEE CSS Technical Committee on Discrete Event Systems".
- Cassandras, C. G.; Lafortune, S. (2008). Introduction to Discrete Event Systems. Springer. ISBN 0-387-33332-0.
- Kumar, Ratnesh; Garg, Vijay K. (1995). Modeling and Control of Logical Discrete Event Systems. Springer. ISBN 978-0-7923-9538-6.
Cori Supercomputer Now Fully Installed at Berkeley Lab
NERSC Users Beginning to Run Science Codes on New 30 Pflop/s System
By David Vincent Bell Hirsch
Supervised learning is the machine learning task of learning a function that maps an input to an output based on example input-output pairs.[1] It infers a function from labeled training data consisting of a set of training examples.[2] In supervised learning, each example is a pair consisting of an input object (typically a vector) and a desired output value (also called the supervisory signal). A supervised learning algorithm analyzes the training data and produces an inferred function, which can be used for mapping new examples. An optimal scenario will allow for the algorithm to correctly determine the class labels for unseen instances. This requires the learning algorithm to generalize from the training data to unseen situations in a "reasonable" way (see inductive bias).
The parallel task in human and animal psychology is often referred to as concept learning.
Hanukkah gelt (Yiddish: חנוכה געלט ḥanukah gelt; Hebrew: דמי חנוכה dmei ḥanukah, both meaning literally "Hanukkah money") typically given to children and sometimes teachers, often in conjunction with the game of Dreidel
TREAT-NMD coordination team
info@treat-nmd.org
Institute of Translational and Clinical Research
University of Newcastle upon Tyne
International Centre for Life
Newcastle upon Tyne
NE1 3BZ
United Kingdom
T: +44 (0)191 241 8839
Good cheer from the Heart of Texas to champion a remedy across the pond.Organic semiconductor
Organic semiconductors are solids whose building blocks are pi-bonded molecules or polymers made up by carbon and hydrogen atoms and – at times – heteroatoms such as nitrogen, sulfur and oxygen. They exist in form of molecular crystals or amorphous thin films. In general, they are electrical insulators, but become semiconducting when charges are either injected from appropriate electrodes, upon doping or by photoexcitation.HPC4EI Application Process
Flask API
Browsable Web APIs for Flask
Streamlit.
Now with sharing.
Deploy, manage, and share your apps with the world, directly from Streamlit — all for free.The study of graphene was starting to go out of style, but new experiments with sheets of the ultrathin material revealed there was much left to learn.
I have been pitching interstate innovations in teaming arrangements and suggest:
What Janet Yellen’s nomination as Treasury secretary means for U.S. policy on China and trade
Physiocracy
U.S. – Mexico – Canada Agreement (USMCA)
the utility of a donkey, who may act as a guard for chicken coop, as fighting off coyotes for example
North American donkeys constitute approximately 0.1% of the worldwide donkey population.[1][a] Donkeys were brought from Europe to the New World in the fifteenth century with the Second Voyage of Christopher Columbus,[2]:179 and subsequently spread into Mexico.[3] They first reached what is now the United States in the late seventeenth century.[4]:11 Donkeys arrived in large numbers in the western United States during the gold rushes of the nineteenth century, as pack animals and for use in mines and ore-grinding mills.[5] From about 1785, some large donkeys were imported from Europe to the eastern part of the continent.[4]:9
There are no true-breeding North American donkey breeds.[6] Breed societies in Canada and the United States register donkeys according to their size, as miniature, standard or mammoth donkeys.[3][7][8] These are reported as breeds to the Domestic Animal Diversity database of the Food and Agriculture Organization of the United Nations by the National Animal Germplasm Program of the Agricultural Research Service of the US Department of Agriculture, as are the Burro – a feral population of the western United States – and the Spotted, a color breed.[9]
Farm/Ranch to Market Facts
The origins of the Democratic donkey can be traced to the 1828 presidential campaign of Andrew Jackson. During that race, opponents of Jackson called him a jackass. However, rather than rejecting the label, Jackson, a hero of the War of 1812 who later served in the U.S. House of Representatives and U.S. Senate, was amused by it and included an image of the animal in his campaign posters. Jackson went on to defeat incumbent John Quincy Adams and serve as America’s first Democratic president. In the 1870s, influential political cartoonist Thomas Nast helped popularize the donkey as a symbol for the entire Democratic Party.
Protect Your Flock With Guard Donkeys
Kick up herd protection on your hobby farm with a guard donkey.
Morocco’s Extraordinary Donkeys
The author returns to Fez, Morocco, to explore the stubborn animal’s central role in the life of this desert kingdom
Under the Skin: what is ejiao?
In the Grand Canyon, the U.S. Postal Service still delivers mail by mule
In Animals, History & Culture / 25 August 2016
By Hannah S. Ostroff
How to Get Smarter Every Day, According to Neuroscience
Education matters. But so does fluid intelligence. Here's how to improve yours.
Monetizing Machine Learning: Quickly Turn Python ML Ideas Into Web Applications on the Serverless Cloud
Monetizing your models with machine learning solutions
Connecting the business user to the science is a necessary step for companies looking to extend their leadership position
Video
How to Monetize AI and Machine Learning Solutions
Social psychology is the scientific study of how the thoughts, feelings, and behaviors of individuals are influenced by the actual, imagined, and implied presence of others. In this definition, scientific refers to empirical investigation using the scientific method, while the terms thoughts, feelings, and behaviors refer to the psychological variables that can be measured in humans. Imagined and implied presences refer to the internalized social norms that humans are influenced by even when alone.[1]
In physics and chemistry, effusion is the process in which a gas escapes from a container through a hole of diameter considerably smaller than the mean free path of the molecules.[1] Such a hole is often described as a pinhole and the escape of the gas is due to the pressure difference between the container and the exterior. Under these conditions, essentially all molecules which arrive at the hole continue and pass through the hole, since collisions between molecules in the region of the hole are negligible. Conversely, when the diameter is larger than the mean free path of the gas, flow obeys the Sampson flow law.
In medical terminology, an effusion refers to accumulation of fluid in an anatomic space, usually without loculation. Specific examples include subdural, mastoid, pericardial and pleural effusions.
Diffusion and Effusion
A New Way to Detect Parkinson’s—by Smell
Discovery of odorous markers for neurodegenerative disease
Another Win for Senolytics: Fighting Aging at the Cellular Level Just Got Easier
Diffusion and redistribution of lipid-like molecules between membranes in virus-cell and cell-cell fusion systems.
Fusion
Water Governance, Stakeholder Engagement, and Sustainable Water Resources ...
edited by Sharon B. Megdal, Susanna Eden,Here’s Who Owns the Most Land in America
The 100 largest private landowners in the U.S. own 40 million acres—an area the size of Florida.
Serpents in the Bible
John Law and the Mississippi Bubble: 1718-1720
On Dec. 15, 2011, the Austin City Council unanimously approved adoption of the Austin Resource Recovery Master Plan. A culmination of two years of research, stakeholder engagement and community input, the Master Plan sets the stage for the Department’s programs and services for the next 30 years and beyond.
The
aim is to reach the City Council’s goal of Zero Waste by 2040, which
means keeping at least 90 percent of discarded materials out of the
landfill. The Master Plan outlines aggressive milestones to ensure that
goal is achieved on time, if not sooner.
Jupiter, Saturn will appear to merge in rare Winter Solstice event not seen in 800 years
The Moon is made of green cheese
Homelessness in Finland
China turns on nuclear-powered 'artificial sun' (Update)
What Ecstasy Does to Octopuses
Despite their wacky brains, these intelligent animals seem to respond to the drug in a very similar way to humans.
Perhaps
Octopussy
007
Sleepless in Seattle
A growing body of research suggests that the foods you eat can affect how well you sleep, and your sleep patterns can affect your dietary choices.
India farmers: Misleading claims about high-profile support
By Shruti Menon
BBC Reality Check
A New Connection between the Gut and Brain
A surprising way that diet leads risks of stroke and cognitive impairment
By Jonathan D. GrinsteinCodependency
Codependency is a relationship imbalance where one person enables another person's addiction, poor mental health, immaturity, irresponsibility, or under-achievement.The war on cocoa: Hershey Co. accused of not upholding sustainability efforts in West Africa
cuckoo for Cocoa Puffs
Daniels Fund Ethics Initiative
University of New Mexico
Many early discussions of animation in the 1930s tended to characterize it in terms of animism, stressing how animation made for an experience.
Texas Disparity minority quantum animism
Be careful with Pudding pops jokes of disparity and deferred adjudication as a social convention... especially when your popsicle is melting with the rule of law as the (Frito) lay of the land. - Dr. Pepper (belch)
Alis volat propriis is a Latin phrase used as the motto of U.S. state of Oregon.
Taking the drug Ecstasy appears to help solve marriage problems, scientists discover
Researchers have suggested that the Class A substance could transform the future of relationship counselling (some researchers did this back in the 1970s also, and the 80s and 90s too, but then one researcher did way to much and then all the others realized the long term costs)
Repeated exposure to MDMA triggers long-term plasticity of noradrenergic and serotonergic neurons
Molecular PsychiatryExclusive: UK regulators give go-ahead for drug to be trialled ahead of possible treatment alongside psychotherapy
Narcissism
How Narcissists Keep Their Mates From Leaving or Cheating
New research explores mate retention behaviors in narcissists’ relationships.
Spain Evicts Francisco Franco's Heirs From Late Dictator's Summer Palace
Goldberg polyhedron
In mathematics, and more specifically in polyhedral combinatorics, a Goldberg polyhedron is a convex polyhedron made from hexagons and pentagons. They were first described by Michael Goldberg (1902–1990) in 1937. They are defined by three properties: each face is either a pentagon or hexagon, exactly three faces meet at each vertex, and they have rotational icosahedral symmetry. They are not necessarily mirror-symmetric; e.g. GP(5,3) and GP(3,5) are enantiomorphs of each other. A Goldberg polyhedron is a dual polyhedron of a geodesic sphere.To tie the knot means to get married. ... Today, the knot tied in marriage is a figurative one, and sometimes a literal one in handfasting ceremonies. The idea of tying the knot dates from at least the 1200s, and probably earlier.
Composite Knot
is a knot that is not a prime knot. Schubert (1949) showed that every knot can be uniquely decomposed (up to the order in which the decomposition is performed) as a knot sum of a class of knots known as prime knots, which cannot themselves be further decomposed (Hoste et al. 1998).Mathematical Physics relies a lot on symmetry to simplify problems, and there are two kinds of diagrams that show up a lot in this context: Dynkin diagrams and Young diagrams.
Dynkin diagrams first show up when you study shapes with lots of reflection symmetries, like crystals and Platonic solids. They wind up being good for all sorts of other stuff, like classifying simple Lie groups and their representations.
In the mathematical field of Lie theory, a Dynkin diagram, named for Eugene Dynkin, is a type of graph with some edges doubled or tripled (drawn as a double or triple line). The multiple edges are, within certain constraints, directed.
What is all the
Fuss–Catalan number
about?
Legal and illegal permutations can be better demonstrated by a specific problem such as balanced brackets (see Dyck language).
Geodesic polyhedra are a good approximation to a sphere for many purposes, and appear in many different contexts. The most well-known may be the geodesic domes designed by Buckminster Fuller, which geodesic polyhedra are named after. Geodesic grids used in geodesy also have the geometry of geodesic polyhedra. The capsids of some viruses have the shape of geodesic polyhedra,[1][2] and fullerene molecules have the shape of Goldberg polyhedra. Geodesic polyhedra are available as geometric primitives in the Blender 3D modeling software package, which calls them icospheres: they are an alternative to the UV sphere, having a more regular distribution of vertices than the UV sphere.[3][4] The Goldberg–Coxeter construction is an expansion of the concepts underlying geodesic polyhedra.
Knots and Numbers
Blender (software)
Blender is a free and open-source 3D computer graphics software toolset used for creating animated films, visual effects, art, 3D printed models, motion graphics, interactive 3D applications, and computer games. Blender's features include 3D modeling, UV unwrapping, texturing, raster graphics editing, rigging and skinning, fluid and smoke simulation, particle simulation, soft body simulation, sculpting, animating, match moving, rendering, motion graphics, video editing, and compositing.
Blender
Vector Math Node
The Goldberg–Coxeter construction or Goldberg–Coxeter operation (GC construction or GC operation) is a graph operation defined on regular polyhedral graphs with degree 3 or 4.[1][2] It also applies to the dual graph of these graphs, i.e. graphs with triangular or quadrilateral "faces". The GC construction can be thought of as subdividing the faces of a polyhedron with a lattice of triangular, square, or hexagonal polygons, possibly skewed with regards to the original face: it is an extension of concepts introduced by the Goldberg polyhedra and geodesic polyhedra. The GC construction is primarily studied in organic chemistry for its application to fullerenes,[1][2] but it has been applied to nanoparticles,[3] computer-aided design,[4] basket weaving,[5][6] and the general study of graph theory and polyhedra.
Kagome lattice
Lidar (/ˈlaɪdɑːr/, also LIDAR, LiDAR, and LADAR) is a method for measuring distances (ranging) by illuminating the target with laser light and measuring the reflection with a sensor. Differences in laser return times and wavelengths can then be used to make digital 3-D representations of the target. It has terrestrial, airborne, and mobile applications.
The term lidar was originally a portmanteau of light and radar.[1][2] It is now also used as an acronym of "light detection and ranging"[3] and "laser imaging, detection, and ranging".[4][5] Lidar sometimes is called 3-D laser scanning, a special combination of a 3-D scanning and laser scanning.
Lidar is commonly used to make high-resolution maps, with applications in surveying, geodesy, geomatics, archaeology, geography, geology, geomorphology, seismology, forestry, atmospheric physics,[6] laser guidance, airborne laser swath mapping (ALSM), and laser altimetry. The technology is also used in control and navigation for some autonomous cars.[7][8]
Superconducting radio frequency
Superconducting radio frequency (SRF) science and technology involves the application of electrical superconductors to radio frequency devices. The ultra-low electrical resistivity of a superconducting material allows an RF resonator to obtain an extremely high quality factor, Q. For example, it is commonplace for a 1.3 GHz niobium SRF resonant cavity at 1.8 kelvins to obtain a quality factor of Q=5×1010. Such a very high Q resonator stores energy with very low loss and narrow bandwidth. These properties can be exploited for a variety of applications, including the construction of high-performance particle accelerator structures.
Oregon Implementation of Workforce Innovation and Opportunity Act (WIOA)
Radio acoustic sounding system
Rarefaction is the reduction of an item's density, the opposite of compression.[1] Like compression, which can travel in waves (sound waves, for instance), rarefaction waves also exist in nature. A common rarefaction wave is the area of low relative pressure following a shock wave (see picture).
Rarefaction waves expand with time (much like sea waves spread out as they reach a beach); in most cases rarefaction waves keep the same overall profile ('shape') at all times throughout the wave's movement: it is a self-similar expansion. Each part of the wave travels at the local speed of sound, in the local medium. This expansion behaviour is in contrast to the behaviour of pressure increases, which gets narrower with time, until they steepen into shock waves.
Mean Free Path
Electron mean free path dependence of the vortex surface impedance
M Checchin1,2, M Martinello1,2, A Grassellino1, A Romanenko1 and J F Zasadzinski2
Published 17 January 2017 • © 2017 IOP Publishing LtdQuantum Biology
Fundamental biological processes that involve the conversion of energy into forms that are usable for chemical transformations are quantum mechanical in its nature. These processes involve chemical reactions. |
Piggybacking (data transmission)
In two-way communication, whenever a frame is received, the receiver waits and does not send the control frame (acknowledgement or ACK) back to the sender immediately.
The receiver waits until its network layer passes in the next data packet. The delayed acknowledgement is then attached to this outgoing data frame.
This technique of temporarily delaying the acknowledgement so that it can be hooked with next outgoing data frame is known as piggybacking.
Working (capital) Principle
Piggybacking data is a bit different from Sliding Protocol used in the OSI model. In the data frame itself, we incorporate one additional field for acknowledgment (called ACK).
Whenever party A wants to send data to party B, it will carry additional ACK information in the PUSH as well.
For example, if A has received 5 bytes from B, which sequence number starts from 12340 (through 12344), A will place "ACK 12345" as well in the current PUSH packet to inform B it has received the bytes up to sequence number 12344 and expects to see 12345 next time. (ACK number is the next sequence number of the data to be PUSHed by the other party.)
Three rules govern the piggybacking data transfer.
- If station A wants to send both data and an acknowledgment, it keeps both fields there.
- If station A wants to send the acknowledgment, after a short period of time to see whether a data frame needs to be sent, then decide whether send an ACK frame alone or attach a data frame with it.
- If station A wants to send just the data, then the previous acknowledgment field is sent along with the data. Station B simply ignores this duplicate ACK frame upon receiving.
Advantages and Disadvantages
Advantages : Improves the efficiency, better use of available channel bandwidth.[1] Disadvantages : The receiver can jam the service if it has nothing to send. This can be solved by enabling a counter (Receiver timeout) when a data frame is received. If the count ends and there is no data frame to send, the receiver will send an ACK control frame. The sender also adds a counter (Emitter timeout), if the counter ends without receiving confirmation, the sender assumes packet loss, and sends the frame again.
References
The Information Age was enabled by technology developed in the Digital Revolution, which was itself enabled by building on the developments of the Technological Revolution.
Transistors
Field-effect transistor
Transconductance
Agreement (linguistics)
Biosensor
Bio-FET
Artificial Precognition ses Data to See the Future
DeepDream
DeepDream is a computer vision program created by Google engineer Alexander Mordvintsev that uses a convolutional neural network to find and enhance patterns in images via algorithmic pareidolia, thus creating a dream-like hallucinogenic appearance in the deliberately over-processed images.[1][2][3]
Google's program popularized the term (deep) "dreaming" to refer to the generation of images that produce desired activations in a trained deep network, and the term now refers to a collection of related approaches.
Economics
Eventually, Information and communication technology (ICT)—i.e. computers, computerized machinery, fiber optics, communication satellites, the Internet, and other ICT tools—became a significant part of the world economy, as the development of microcomputers greatly changed many businesses and industries.[20][21] Nicholas Negroponte captured the essence of these changes in his 1995 book, Being Digital, in which he discusses the similarities and differences between products made of atoms and products made of bits.[22] In essence, a copy of a product made of bits can be made cheaply and quickly, then expediently shipped across the country or the world at very low cost.
Jobs and income distribution
The Information Age has affected the workforce in several ways, such as compelling workers to compete in a global job market. One of the most evident concerns is the replacement of human labor by computers that can do their jobs faster and more effectively, thus creating a situation in which individuals who perform tasks that can easily be automated are forced to find employment where their labor is not as disposable.[23] This especially creates issue for those in industrial cities, where solutions typically involve lowering working time, which is often highly resisted. Thus, individuals who lose their jobs may be pressed to move up into joining "mind workers" (e.g. engineers, doctors, lawyers, teachers, professors, scientists, executives, journalists, consultants), who are able to compete successfully in the world market and receive (relatively) high wages.[24]
Along with automation, jobs traditionally associated with the middle class (e.g. assembly line, data processing, management, and supervision) have also begun to disappear as result of outsourcing.[25] Unable to compete with those in developing countries, production and service workers in post-industrial (i.e. developed) societies either lose their jobs through outsourcing, accept wage cuts, or settle for low-skill, low-wage service jobs.[25] In the past, the economic fate of individuals would be tied to that of their nation's. For example, workers in the United States were once well paid in comparison to those in other countries. With the advent of the Information Age and improvements in communication, this is no longer the case, as workers must now compete in a global job market, whereby wages are less dependent on the success or failure of individual economies.[25]
In effectuating a globalized workforce, the internet has just as well allowed for increased opportunity in developing countries, making it possible for workers in such places to provide in-person services, therefore competing directly with their counterparts in other nations. This competitive advantage translates into increased opportunities and higher wages.[26]
Automation, productivity, and job gain
The Information Age has affected the workforce in that automation and computerisation have resulted in higher productivity coupled with net job loss in manufacturing. In the United States, for example, from January 1972 to August 2010, the number of people employed in manufacturing jobs fell from 17,500,000 to 11,500,000 while manufacturing value rose 270%.[27]
Although it initially appeared that job loss in the industrial sector might be partially offset by the rapid growth of jobs in information technology, the recession of March 2001 foreshadowed a sharp drop in the number of jobs in the sector. This pattern of decrease in jobs would continue until 2003,[28] and data has shown that, overall, technology creates more jobs than it destroys even in the short run.[29]
Information-intensive industry
Industry has become more information-intensive while less labor- and capital-intensive. This has left important implications for the workforce, as workers have become increasingly productive as the value of their labor decreases. For the system of capitalism itself, not only is the value of labor decreased, the value of capital is also diminished.
In the classical model, investments in human and financial capital are important predictors of the performance of a new venture.[30] However, as demonstrated by Mark Zuckerberg and Facebook, it now seems possible for a group of relatively inexperienced people with limited capital to succeed on a large scale.[31]
How do you like them quantum biology analyte apple innovations with spintronics?
By David Vincent Bell Hirsch
A new half-sized Mac Pro is planned for launch by 2022
ARM processor
Prakriti and Vikriti in Ayurveda Explained
1149 S. Hill Street Ste. 900
Los Angeles, CA 90015
213-694-2826
Research Interests
Networking considerations for
Collagen Type VI-Related Disorders
Anne Katrin Lampe, MD, Kevin M Flanigan, MD, Katharine Mary Bushby, MD, MBCHB FRCP, and Debbie Hicks, PhD.
Clinical characteristics.
Collagen type
VI-related disorders represent a continuum of overlapping phenotypes
with Bethlem myopathy at the mild end, Ullrich congenital muscular dystrophy (CMD) at the severe end, and two rare, less well-defined disorders – autosomal dominant limb-girdle muscular dystrophy and autosomal recessive
myosclerosis myopathy – in between. Although Bethlem myopathy and
Ullrich CMD were defined long before their molecular basis was known,
they remain useful for clarification of prognosis and management.
Bethlem
myopathy, characterized by the combination of proximal muscle weakness
and variable contractures, affects most frequently the long finger
flexors, elbows, and ankles. Onset may be prenatal (characterized by
decreased fetal movements), neonatal (hypotonia or torticollis), in
early childhood (delayed motor milestones, muscle weakness, and
contractures), or in adulthood (proximal weakness and Achilles tendon or
long finger flexor contractures). Because of slow progression, more
than two thirds of affected
individuals over age 50 years rely on supportive means for outdoor
mobility. Respiratory involvement is rare and appears to be related to
more severe muscle weakness in later life.
Ullrich CMD is characterized by congenital weakness and hypotonia, proximal joint contractures, and striking hyperlaxity of distal joints. Some affected
children acquire the ability to walk independently; however,
progression of the disease often results in later loss of ambulation.
Early and severe respiratory involvement may require ventilatory support
in the first or second decade of life.
TREAT-NMD coordination team
info@treat-nmd.org
Institute of Translational and Clinical Research
University of Newcastle upon Tyne
International Centre for Life
Newcastle upon Tyne
NE1 3BZ
United Kingdom
T: +44 (0)191 241 8839
Good cheer from the Heart of Texas to champion a remedy across the pond.
Tableau vivant
A static scene renders a single dynamic movie or video asset. Static means that there is no condition or variable attached to the scene and the scenes are always played. You use static scenes for intro and outro scenes in a longer, or more complex story.
I am reading professor Datta's Lessons from Nanoelectronics and considering:
Electrostatic Potential
Molecular Electrostatic Potentials
Drift-Diffusion Model: Introduction Prepared by: Dragica Vasileska Associate Professor Arizona State University
Poisson–Boltzmann equation
Thank you for your development direction NASA Small Business
Advanced Theory of Semiconductors and Semiconductor DevicesNumerical Methods and Simulation / Umberto RavaioliReview of Conventional Semiconductor Device ModelsBased on Partial Differential Equations
See all authors and affiliations
Electrochemical cell
Bi-allelic mutations in uncoordinated mutant number-45 myosin chaperone B are a cause for congenital myopathy
- Hormos Salimi Dafsari,
- Nur Mehpare Kocaturk,
- Hülya-Sevcan Daimagüler,
- Anna Brunn,
- Jörg Dötsch,
- Joachim Weis,
- Martina Deckert &
- Sebahattin Cirak
Lecture Prepared By:Sanjoy Mukherjee
A fusion gene is a hybrid gene formed from two previously independent genes. It can occur as a result of translocation, interstitial deletion, or chromosomal inversion. Fusion genes have been found to be prevalent in all main types of human neoplasia.
The Drosophila sticks-and-stones (sns) locus was
identified on the basis of its mutant phenotype, the complete absence of
body wall muscles and corresponding presence
of unfused myoblasts. The genetic location of the
mutation responsible for this apparent defect in myoblast fusion was
determined
by recombination and deficiency mapping, and the
corresponding wild-type gene was isolated in a molecular walk.
Walking molecules
In magnetism the Stoner–Wohlfarth astroid
curve is a curve that separates regions with two minima of the free
energy density from those with only one energy minimum.
Brownian motor
I have been researching nanoelectronics
Brownian motors are nanoscale or molecular machines that use chemical reactions to generate directed motion in space.[1] The theory behind Brownian motors relies on the phenomena of Brownian motion, random motion of particles suspended in a fluid (a liquid or a gas) resulting from their collision with the fast-moving molecules in the fluid.[2]
The concept of Brownian motors is a recent one, having only been coined in 1995 by Peter Hänggi, but the existence of such motors in nature may have existed for a very long time and help to explain crucial cellular processes that require movement at the nanoscale, such as protein synthesis and muscular contraction.
Magnetic field
Electric field
Crystal structures of human cardiac β-myosin II S2-Δ provide insight into the functional role of the S2 subfragment
Wulf Blankenfeldt, Nicolas H. Thomä, John S. Wray, Mathias Gautel, and Ilme Schlichting
In the philosophy of thermal and statistical physics, the Brownian ratchet or Feynman–Smoluchowski ratchet is an apparent perpetual motion machine first analysed in 1912 as a thought experiment by Polish physicist Marian Smoluchowski.[1] It was popularised by American Nobel laureate physicist Richard Feynman in a physics lecture at the California Institute of Technology on May 11, 1962, during his Messenger Lectures series The Character of Physical Law in Cornell University in 1964 and in his text The Feynman Lectures on Physics[2] as an illustration of the laws of thermodynamics. The simple machine, consisting of a tiny paddle wheel and a ratchet, appears to be an example of a Maxwell's demon, able to extract useful work from random fluctuations (heat) in a system at thermal equilibrium in violation of the second law of thermodynamics. Detailed analysis by Feynman and others showed why it cannot actually do this.
Experimental realization of Feynman's ratchet
Jaehoon Bang8,1, Rui Pan8,2
, Thai M Hoang9,3, Jonghoon Ahn1, Christopher Jarzynski4
Feynman's lectures
Ratchet and pawl
we may also consider applications in physics
The electron inelastic mean free path
(IMFP) is an important quantity for electron spectroscopy and
microscopy techniques. ... The experimental and theoretical results show
that the IMFP for monolayer graphene is almost constant (about 1 nm) in the energy range of 6–100 eV.
How
to Get Into Carnegie Mellon: The Admissions Criteria. Carnegie Mellon
is one of the most competitive private colleges or universities in the
US, with a 21.70% acceptance rate, an average of 1465 on the SAT, an
average of 33 on the ACT and an rough average unweighted GPA of 4 (unofficial).
Look at the size of 'em mellons, use egg heads!
The Rockefeller clan did really originate from a guy who was a notorious snake oil salesman – William Avery, Devil Bill Rockefeller
n'yuk n'yuk n'yuk, i love n'yuk Heart of Texas
The heart is the most powerful source of electromagnetic energy in the human body, producing the largest rhythmic electromagnetic field of any of the body's organs. ... The heart's magnetic field can be measured several feet away from the body by sensitive magnetometers.
Magnetocardiography
The
Python Package Index, abbreviated as PyPI and also known as the Cheese
Shop, is the official third-party software repository for Python. It is
analogous to CPAN, the repository for Perl. Some package managers,
including pip, use PyPI as the default source for packages and their
dependencies In 10 (Mostly Easy) Steps
consider
Nanowire
DNA-templated metallic nanowire synthesis
DNA Macrostructure
k-permutations of n
Permutations with repetition (fractal?))
DNA methyltransferase
Nanowire
Nanowires
are desirable due to their capability to interface with other nano-micro
scale systems, realization of nano-bio devices due to their size regime
being similar to biological macromolecules, and single nanowire-based
device integration.
Sequence permutations in the molecular evolution of DNA methyltransferases
DNA - GATTACAGATTACAGATTACA,
YASARA scores all permutations of protonation states to find the best oneOrganic semiconductor
Organic semiconductors are solids whose building blocks are pi-bonded molecules or polymers made up by carbon and hydrogen atoms and – at times – heteroatoms such as nitrogen, sulfur and oxygen. They exist in form of molecular crystals or amorphous thin films. In general, they are electrical insulators, but become semiconducting when charges are either injected from appropriate electrodes, upon doping or by photoexcitation. Optoelectronics
Cavendish Laboratory, Cambridge
Organic superconductor
Introduction to Organic Metals
Organic Superconductors
Clark University
Myosin
Empty string
Susan M. Abmayr, Grace K. Pavlath
Development 2012 139: 641-656; doi: 10.1242/dev.068353The clique cover number of a graph G is the smallest number of cliques of G whose union covers the set of vertices V of the graph. A maximum clique transversal of a graph is a subset of vertices with the property that each maximum clique of the graph contains at least one vertex in the subset.
A clique (AusE, CanE, UK: /ˈkliːk/ or US: /ˈklɪk/), in the social
sciences, is a group of individuals who interact with one another and
share similar interests. ... They are often bound together by shared social characteristics such as ethnicity and socioeconomic status.
Emotional Agility helps
Molecular features of the UNC-45 chaperone critical for binding and folding muscle myosin
Air Education and Training Command was established 1 July 1993,
with the realignment of Air Training Command and Air University. It is
one of the U.S. Air Force's nine major commands and reports to
Headquarters, United States Air Force.
AETC is headquartered at Randolph Air Force Base, Joint Base San Antonio
Texas
Randolph Air Force Base in Universal City, TX
Universal City, Texas Military Bases
Randolph AFB is an Air Force operated military base located in the middle of Texas, only 24 km away from San Antonio.
Lackland Air Force Base in San Antonio, TX
San Antonio, Texas Military Bases
Lackland
is a U.S. Air Force base that is located in San Antonio, Texas and is
named after Brigadier General Frank Lackland. It is currently under the
authority of the 802d Mission Support Group, Air Education and Training
Command, or commonly known as the AETC.
Microbiology
Why Microbiology Matters
The study of microbes helps us to understand our world and our place within it
ASM Journals
The New Microbiology Spectrum
Announcing ASM’s new open access journal, Microbiology Spectrum. The journal will publish technically sound research studies in all areas of microbial sciences. Coming Spring 2021.
Microbiology is the study of microorganisms (also known as microbes),
which are unicellular or cell-cluster organisms and infectious agents
too small to be seen with the naked eye. This includes eukaryotes
(organisms with a nucleus), such as fungi and protists, and prokaryotes
(organisms without a nucleus), such as bacteria.
A fundamental understanding of how a cell works has come through the
study of microorganisms. But microbiology also is an applied science,
helping agriculture, health and medicine and maintenance of the
environment, as well as the biotechnology industry. Microbiologists
study microbes at the level of the community (ecology and epidemiology),
at the level of the cell (cell biology and physiology) and at the level
of proteins and genes (molecular biology).
Microorganisms are extremely important in our everyday lives. Some
are responsible for a significant proportion of the diseases affecting
not only humans, but also plants and animals, while others are vitally
important in the maintenance and modification of our environment. Still
others play an essential role in industry, where their unique properties
have been harnessed in the production of food, beverages and
antibiotics. Scientists also have learned how to exploit microorganisms
in the field of molecular biology, which makes an enormous impact both
industrially and medically. Microbiology also encompasses immunology,
the study of the body’s ability to mount defenses against infectious
microbes.
Because microbiology, by definition, studies organisms not visible to
the naked eye, we can consider late-17th-century Dutch scientist Antony
van Leeuwenhoek the father of the discipline. Leeuwenhoek was the first
person to describe tiny cells and bacteria, and he invented new methods
for grinding and polishing microscope lenses that allowed for
curvatures providing magnifications of up to 270 diameters, the best
available lenses at that time. But while van Leeuwenhoek is cited as the
first microbiologist, the first recorded microbiological observation —
the fruiting bodies of molds — was made earlier, in 1665, by English
physicist Robert Hooke.
Other notable people in the history of science who made fundamental
discoveries about microorganisms are 19th-century scientists Louis
Pasteur and Robert Koch, who are considered the founders of medical
microbiology. Pasteur is most famous for his series of experiments
designed to disprove the then-widely held theory of spontaneous
generation, which solidified microbiology’s identity as a biological
science. Pasteur also designed methods for food preservation
(pasteurization) and vaccines against several diseases, such as anthrax,
fowl cholera and rabies. Koch is best known for his contributions to
the germ theory of disease, proving that specific diseases were caused
by specific pathogenic microorganisms. He developed a series of criteria
that have become known as Koch’s postulates. Koch was one of the first
scientists to focus on the isolation of bacteria in pure culture,
resulting in his description of several novel bacteria, including Mycobacterium tuberculosis, the causative agent of tuberculosis.
Finally, some of the most important discoveries affecting public
health occurred in the 20th century, such as the discovery of penicillin
by Alexander Fleming, which started a rush to find other natural, and
eventually synthetic, antibiotics; the development of vital vaccines,
including those for polio and yellow fever; and the birth of molecular
biology, which happened in the 1940s with the study of bacteria
Application of Machine Learning in Microbiology
Drones and Machine Learning may be implemented for the EPA, NASA and DARPA
Machine learning for the meta-analyses of microbial pathogens’ volatile signatures
- Susana I. C. J. Palma,
- Ana P. Traguedo,
- Ana R. Porteira,
- Maria J. Frias,
- Hugo Gamboa &
- Ana C. A. Roque
Scientific Reports
volume 8, Article number: 3360 (2018)
Because drones can be quickly deployed over disaster
zones, responders are using them to produce 3D maps, scan for victims,
and assess damaged infrastructure. These, among other applications, have
cemented the role of drones as an essential part of emergency disaster response
May 5, 2020
Drones for Disaster Response: NASA STEReO Project Kicks Off
Jorge Ayala, Regional Director
903 San Jacinto
Suite 206
Austin, Texas 78701
P: 512-381-8144
F: 512-499-0478
E: jayala@eda.gov
Collagen Type VI-Related Disorders
Anne Katrin Lampe, MD, Kevin M Flanigan, MD, Katharine Mary Bushby, MD, MBCHB FRCP, and Debbie Hicks, PhD.
Clinical characteristics.
Collagen type VI-related disorders represent a continuum of overlapping phenotypes with Bethlem myopathy at the mild end, Ullrich congenital muscular dystrophy (CMD) at the severe end, and two rare, less well-defined disorders – autosomal dominant limb-girdle muscular dystrophy and autosomal recessive myosclerosis myopathy – in between. Although Bethlem myopathy and Ullrich CMD were defined long before their molecular basis was known, they remain useful for clarification of prognosis and management.
Bethlem myopathy, characterized by the combination of proximal muscle weakness and variable contractures, affects most frequently the long finger flexors, elbows, and ankles. Onset may be prenatal (characterized by decreased fetal movements), neonatal (hypotonia or torticollis), in early childhood (delayed motor milestones, muscle weakness, and contractures), or in adulthood (proximal weakness and Achilles tendon or long finger flexor contractures). Because of slow progression, more than two thirds of affected individuals over age 50 years rely on supportive means for outdoor mobility. Respiratory involvement is rare and appears to be related to more severe muscle weakness in later life.
Ullrich CMD is characterized by congenital weakness and hypotonia, proximal joint contractures, and striking hyperlaxity of distal joints. Some affected children acquire the ability to walk independently; however, progression of the disease often results in later loss of ambulation. Early and severe respiratory involvement may require ventilatory support in the first or second decade of life.
TREAT-NMD coordination team
info@treat-nmd.org
Institute of Translational and Clinical Research
University of Newcastle upon Tyne
International Centre for Life
Newcastle upon Tyne
NE1 3BZ
United Kingdom
T: +44 (0)191 241 8839
Good cheer from the Heart of Texas to champion a remedy across the pond.Tableau vivant
I am reading professor Datta's Lessons from Nanoelectronics and considering:
Electrostatic Potential
Molecular Electrostatic Potentials
Poisson–Boltzmann equation
See all authors and affiliations
Electrochemical cell
Bi-allelic mutations in uncoordinated mutant number-45 myosin chaperone B are a cause for congenital myopathy
- Hormos Salimi Dafsari,
- Nur Mehpare Kocaturk,
- Hülya-Sevcan Daimagüler,
- Anna Brunn,
- Jörg Dötsch,
- Joachim Weis,
- Martina Deckert &
- Sebahattin Cirak
Walking molecules
Brownian motor
Brownian motors are nanoscale or molecular machines that use chemical reactions to generate directed motion in space.[1] The theory behind Brownian motors relies on the phenomena of Brownian motion, random motion of particles suspended in a fluid (a liquid or a gas) resulting from their collision with the fast-moving molecules in the fluid.[2]
Crystal structures of human cardiac β-myosin II S2-Δ provide insight into the functional role of the S2 subfragment
Experimental realization of Feynman's ratchet
Jaehoon Bang8,1, Rui Pan8,2
, Thai M Hoang9,3, Jonghoon Ahn1, Christopher Jarzynski4Ratchet and pawl
Magnetocardiography
The Python Package Index, abbreviated as PyPI and also known as the Cheese Shop, is the official third-party software repository for Python. It is analogous to CPAN, the repository for Perl. Some package managers, including pip, use PyPI as the default source for packages and their dependenciesIn 10 (Mostly Easy) Steps
Nanowire
DNA-templated metallic nanowire synthesis
DNA Macrostructure
k-permutations of n
Permutations with repetition (fractal?))
DNA methyltransferase
Nanowire
Nanowires are desirable due to their capability to interface with other nano-micro scale systems, realization of nano-bio devices due to their size regime being similar to biological macromolecules, and single nanowire-based device integration.
Sequence permutations in the molecular evolution of DNA methyltransferases
YASARA scores all permutations of protonation states to find the best one
Organic semiconductor
Organic semiconductors are solids whose building blocks are pi-bonded molecules or polymers made up by carbon and hydrogen atoms and – at times – heteroatoms such as nitrogen, sulfur and oxygen. They exist in form of molecular crystals or amorphous thin films. In general, they are electrical insulators, but become semiconducting when charges are either injected from appropriate electrodes, upon doping or by photoexcitation.Optoelectronics
Cavendish Laboratory, Cambridge
Organic superconductor
Introduction to Organic Metals
Organic Superconductors
Clark University
Myosin
Empty string
Molecular features of the UNC-45 chaperone critical for binding and folding muscle myosin
Randolph Air Force Base in Universal City, TX
Universal City, Texas Military Bases
Randolph AFB is an Air Force operated military base located in the middle of Texas, only 24 km away from San Antonio.
Lackland Air Force Base in San Antonio, TX
San Antonio, Texas Military Bases
Lackland
is a U.S. Air Force base that is located in San Antonio, Texas and is
named after Brigadier General Frank Lackland. It is currently under the
authority of the 802d Mission Support Group, Air Education and Training
Command, or commonly known as the AETC.
Microbiology
Why Microbiology Matters
The study of microbes helps us to understand our world and our place within it
ASM Journals
The New Microbiology Spectrum
Announcing ASM’s new open access journal, Microbiology Spectrum. The journal will publish technically sound research studies in all areas of microbial sciences. Coming Spring 2021.
Microbiology is the study of microorganisms (also known as microbes), which are unicellular or cell-cluster organisms and infectious agents too small to be seen with the naked eye. This includes eukaryotes (organisms with a nucleus), such as fungi and protists, and prokaryotes (organisms without a nucleus), such as bacteria.
A fundamental understanding of how a cell works has come through the study of microorganisms. But microbiology also is an applied science, helping agriculture, health and medicine and maintenance of the environment, as well as the biotechnology industry. Microbiologists study microbes at the level of the community (ecology and epidemiology), at the level of the cell (cell biology and physiology) and at the level of proteins and genes (molecular biology).
Microorganisms are extremely important in our everyday lives. Some are responsible for a significant proportion of the diseases affecting not only humans, but also plants and animals, while others are vitally important in the maintenance and modification of our environment. Still others play an essential role in industry, where their unique properties have been harnessed in the production of food, beverages and antibiotics. Scientists also have learned how to exploit microorganisms in the field of molecular biology, which makes an enormous impact both industrially and medically. Microbiology also encompasses immunology, the study of the body’s ability to mount defenses against infectious microbes.
Because microbiology, by definition, studies organisms not visible to the naked eye, we can consider late-17th-century Dutch scientist Antony van Leeuwenhoek the father of the discipline. Leeuwenhoek was the first person to describe tiny cells and bacteria, and he invented new methods for grinding and polishing microscope lenses that allowed for curvatures providing magnifications of up to 270 diameters, the best available lenses at that time. But while van Leeuwenhoek is cited as the first microbiologist, the first recorded microbiological observation — the fruiting bodies of molds — was made earlier, in 1665, by English physicist Robert Hooke.
Other notable people in the history of science who made fundamental discoveries about microorganisms are 19th-century scientists Louis Pasteur and Robert Koch, who are considered the founders of medical microbiology. Pasteur is most famous for his series of experiments designed to disprove the then-widely held theory of spontaneous generation, which solidified microbiology’s identity as a biological science. Pasteur also designed methods for food preservation (pasteurization) and vaccines against several diseases, such as anthrax, fowl cholera and rabies. Koch is best known for his contributions to the germ theory of disease, proving that specific diseases were caused by specific pathogenic microorganisms. He developed a series of criteria that have become known as Koch’s postulates. Koch was one of the first scientists to focus on the isolation of bacteria in pure culture, resulting in his description of several novel bacteria, including Mycobacterium tuberculosis, the causative agent of tuberculosis.
Finally, some of the most important discoveries affecting public health occurred in the 20th century, such as the discovery of penicillin by Alexander Fleming, which started a rush to find other natural, and eventually synthetic, antibiotics; the development of vital vaccines, including those for polio and yellow fever; and the birth of molecular biology, which happened in the 1940s with the study of bacteria
Application of Machine Learning in Microbiology
Machine learning for the meta-analyses of microbial pathogens’ volatile signatures
- Susana I. C. J. Palma,
- Ana P. Traguedo,
- Ana R. Porteira,
- Maria J. Frias,
- Hugo Gamboa &
- Ana C. A. Roque
Scientific Reports volume 8, Article number: 3360 (2018)
Drones for Disaster Response: NASA STEReO Project Kicks Off
Jorge Ayala, Regional Director
903 San Jacinto
Suite 206
Austin, Texas 78701
P: 512-381-8144
F: 512-499-0478
E: jayala@eda.gov
Science and Technology for Autonomous Teammates (STAT)
Incapacity Planning with ABLE Accounts v. Other Supports
Viral envelope
Context:
ARC: Activity-regulated cytoskeleton-associated protein
The Ark of the Covenant (Hebrew: אָרוֹן הַבְּרִית, Modern: Arōn Ha'brēt, Tiberian: ʾĀrôn Habbərîṯ; Koinē Greek: Κιβωτός της διαθήκης), also known as the Ark of the Testimony, and in a few verses across various translations as the Ark of God, is a gold-covered wooden chest with lid cover described in the Book of Exodus as containing the two stone tablets of the Ten Commandments. According to various texts within the Hebrew Bible, it also contained Aaron's rod and a pot of manna.[3] In the Christian New Testament, Hebrews 9:4 reads that "The ark of the covenant [was] covered on all sides with gold, in which was a golden jar holding the manna, and Aaron's rod which budded, and the tablets of the covenant."[4]
Prophase
6.17. Using Python
TensorFlow is a Python
library for fast numerical computing created and released by Google. It
is a foundation library that can be used to create Deep Learning models
directly or by using wrapper libraries that simplify the process built
on top of TensorFlow. What is TensorFlow used for? It
is an open source artificial intelligence library, using data flow
graphs to build models. It allows developers to create large-scale
neural networks with many layers. TensorFlow is mainly used for: Classification, Perception, Understanding, Discovering, Prediction and Creation
Selenium is a portable framework for testing web applications.
Selenium provides a playback tool for authoring functional tests without
the need to learn a test scripting language. |
Americans with Disabilities Act of 1990
The Concept of the "Triune Brain"
"Mind-monkey" in English
Please Meet Your Monkey Mind
By Executive Director Heidi HannaHundredth monkey effect
China claims fastest quantum computer in the world
ByCollective representations
In physics, spacetime is any mathematical model that combines space and time into a single continuum. It is a mathematical concept used to refer to all points of space and time and their relation to each other. Historically, space and time were thought of as separate entities. Time was thought to pass at the same rate for all observers, regardless of where they were or how fast they were moving. Similarly, measurements of distance were thought to be the same for everyone. When Albert Einstein developed the idea of spacetime, he showed that measurements of time and distance between the same events could differ for different observers. But at the same time, he showed that these measurements could be combined in a systematic way.
This combination simplified previously existing theories such as electromagnetism, and was central to the development of almost all fundamental physics since. Quantum field theory, which describes the fundamental particles that make up our universe, was invented by considering how quantum mechanics would work in a unified spacetime. Furthermore, considering how spacetime could be warped or bent led to the development of general relativity, which describes how gravity works.
Time complexity
Polynomial time
process flowchart, process flow diagram
Variations: macro flowchart, top-down flowchart, detailed flowchart (also called process map, micro map, service map, or symbolic flowchart), deployment flowchart (also called down-across or cross-functional flowchart), several-leveled flowchart
A flowchart is a picture of the separate steps of a process in sequential order.Examples of vector spaces
Polynomial vector spaces
Intractability
Brute-force search
Brute Force Algorithms Explained
An interview from the archives with physicist and philosopher David Bohm
Special & General Relativity Questions and Answers
What is the relationship between space and time?
Mathematically, and in accordance with relativity, they are in some sense
interchangeable, but we do know that they form co-equal parts of a larger
'thing' called space-time, and it is only within space-time that the most
complete understanding of the motion and properties of natural objects and
phenomena can be rigorously understood by physicists. Space and time are to
space-time what arms and legs are to humans. In some sense they are
interchangeable, but you cannot understand 10,000 years of human history
without including both arms and legs as part of the basic human condition
CRISPR and another genetic strategy fix cell defects in two common blood disorders
By Jocelyn KaiserAndrew Yan-Tak Ng (Chinese: 吳恩達; born 1976) is a British-born American businessman, computer scientist, investor, and writer. He is focusing on machine learning and AI.[2] As a businessman and investor, Ng co-founded and led Google Brain and was a former Vice President and Chief Scientist at Baidu, building the company's Artificial Intelligence Group into a team of several thousand people.[3]
Ng is an adjunct professor at Stanford University (formerly associate professor and Director of its AI Lab). Also a pioneer in online education, Ng co-founded Coursera and deeplearning.ai.[4] He has successfully spearheaded many efforts to "democratize deep learning" teaching over 2.5 million students through his online courses.[5][2] He is one of the world's most famous and influential computer scientists being named one of Time magazine's 100 Most Influential People in 2012, and Fast Company's Most Creative People in 2014. Since 2018 he launched and currently heads AI Fund, initially a $175-million investment fund for backing artificial intelligence startups. He has founded Landing AI, which provides AI-powered SaaS products and Transformation Program to empower enterprises into cutting-edge AI companies.[6]
Harvard
Machine Learning + Human Learning
Quantum/Affine Schubert Calculus5 August - 9 August 2013
University of Oregon
SEE ALSO: Composite Link, Factor Knot, Granny Knot, Knot, Link, Prime Knot, Satellite Knot
Why we need to rethink education in the artificial intelligence age
John R. Allen Thursday, January 31, 2019Artificial intelligence is starting to take over repetitive tasks in classrooms, like grading, and is optimizing coursework and revolutionizing the preparation for college entrance exams.
Materials science in the artificial intelligence age: high-throughput library generation, machine learning, and a pathway from correlations to the underpinning physics
Published online by Cambridge University Press: 22 July 2019
The UConn IDEA Grant program awards funding to support student-designed and student-led projects, including creative endeavors, community service initiatives, entrepreneurial ventures, research projects, and other original and innovative projects.
Bachelor of Liberal Studies
Undergraduate Math Student Pushes Frontier of Graph Theory
Ballistic conduction
Ballistic thermal transport
Heat conduction can experience ballistic thermal transport when heating size is larger than phonon mean free paths. Ballistic thermal transport has been observed in multiple materials systemsConservative force
Work and heat change the internal energy of asystem
quantum biological considerations:
Gauss's Law
In the 18th century, French philosopher Georges-Louis Leclerc, Comte de Buffon determined that you can approximate pi by dropping needles on a grid of parallel lines (whose spacing is greater than the length of a needle) and calculating the probability that they will cross a line.
Buffon's noodle
List of semiconductor materials
How to Calculateπ: Buffon’s Needle (Non-calculus version)
Dominic Klyve∗February 5, 2019
Brownian motor
Brownian motors are nanoscale or molecular machines that use chemical reactions to generate directed motion in space.[1] The theory behind Brownian motors relies on the phenomena of Brownian motion, random motion of particles suspended in a fluid (a liquid or a gas) resulting from their collision with the fast-moving molecules in the fluid.[2]
On the nanoscale (1-100 nm), viscosity dominates inertia, and the extremely high degree of thermal noise in the environment makes conventional directed motion all but impossible, because the forces impelling these motors in the desired direction are minuscule when compared to the random forces exerted by the environment. Brownian motors operate specifically to utilise this high level of random noise to achieve directed motion, and as such are only viable on the nanoscale.[3]
The concept of Brownian motors is a recent one, having only been coined in 1995 by Peter Hänggi, but the existence of such motors in nature may have existed for a very long time and help to explain crucial cellular processes that require movement at the nanoscale, such as protein synthesis and muscular contraction. If this is the case, Brownian motors may have implications for the foundations of life itself
In more recent times, humans have attempted to apply this knowledge of natural Brownian motors to solve human problems. The applications of Brownian motors are most obvious in nanorobotics due to its inherent reliance on directed motion.[3]
Kinesin, an example of a molecular motor that uses ATP to "walk" along nanotubules, is now thought to be an example of a Brownian motor.
Dreidel driven scientific research!
In more recent times, humans have attempted to apply this knowledge of natural Brownian motors to solve human problems. The applications of Brownian motors are most obvious in nanorobotics due to its inherent reliance on directed motion.
Implementing the Drude Polarizable Force Field in NAMD
Theoretical and Computational Biophysics Group
Meiosis: Telomeres lead chromosome movement
Jürg KohliPotassium channel
Potassium channels are the most widely distributed type of ion channel and are found in virtually all living organisms.Piezoelectric microelectromechanical systems
Proton–proton chain reaction
Fragments of energy – not waves or particles – may be the fundamental building blocks of the universe
Professor of Mechanical and Aerospace Engineering, North Carolina State University
A Chemically Reversible Brownian Motor: Application to Kinesin and Ncd
Spin-orbit torque-driven skyrmion dynamics revealed by time-resolved X-ray microscopy
A spiking neuron constructed by the skyrmion-based spin torque nano-oscillator
Task Stack and Heap
IT is a PUSH, POP... a Stack machine
Pointer Graph Networks
Computational complexity theory
NP-completeness
NP-complete problems
NP-hardness
Stack-Pointer Networks for Dependency Parsing
Stack register
Stack engine
The Madelung constant is used in determining the electrostatic potential of a single ion in a crystal by approximating the ions by point charges. It is named after Erwin Madelung, a German physicist.[1]
Because the anions and cations in an ionic solid attract each other by virtue of their opposing charges, separating the ions requires a certain amount of energy. This energy must be given to the system in order to break the anion–cation bonds. The energy required to break these bonds for one mole of an ionic solid under standard conditions is the lattice energy.
Four-color theorem linked to crystal's magnetic properties
Quadrupole ion trap
Torsion (mechanics)
Properties
Effective limit theorems for Markov chains with a spectral gap
Benoît R. Kloeckner∗
October 31, 2018
SMWVBO December Conference
A staff (head) gauge is calibrated scale which is used to provide a visual indication of liquid level. When used on an inclined or sloped surface, a staff gauge is usually calibrated so that the indicated level is the true vertical level.
Staff gauges are commonly installed at stream gauging stations to indicate the water stage. They are also used to indicate the water level (and hence flow rate) in open channel primary devices (flumes or weirs).
See also
The Bureau of Reclamation (U.S. Department of the Interior) - Established in 1902, the Bureau of Reclamation is best known for the dams, powerplants, and canals it constructed in the 17 western states. These water projects led to homesteading and promoted the economic development of the West.CHAPTER 6 - MEASURING AND RECORDING WATER STAGE OR HEAD
7. Stilling Well Considerations
Conservative vector field
Informal treatment
Telemetry
Telemetry is the in situ collection of measurements or other data at remote points and their automatic transmission to receiving equipment (telecommunication) for monitoring. The word is derived from the Greek roots tele, "remote", and metron, "measure". Systems that need external instructions and data to operate require the counterpart of telemetry, telecommand.
Although the term commonly refers to wireless data transfer mechanisms (e.g., using radio, ultrasonic, or infrared systems), it also encompasses data transferred over other media such as a telephone or computer network, optical link or other wired communications like power line carriers. Many modern telemetry systems take advantage of the low cost and ubiquity of GSM networks by using SMS to receive and transmit telemetry data.
A telemeter is a physical device used in telemetry. It consists of a sensor, a transmission path, and a display, recording, or control device. Electronic devices are widely used in telemetry and can be wireless or hard-wired, analog or digital. Other technologies are also possible, such as mechanical, hydraulic and optical.[3]
Telemetry may be commutated to allow the transmission of multiple data streams in a fixed frame.
To Read Someone's Mind, Look into Their Eyes
The phrase “the eyes are the window to the soul” isn't just poetry
Neurological pupil index
Clinicians routinely check the pupils of critically injured and ill patients to monitor neurological status. However, manual pupil measurements (performed using a penlight or ophthalmoscope) have been shown to be subjective, inaccurate, and not repeatable or consistent.[1] Automated assessment of the pupillary light reflex has emerged as an objective means of measuring pupillary reactivity across a range of neurological diseases, including stroke, traumatic brain injury and edema, tumoral herniation syndromes, and sports or war injuries.
Automated pupillometers use infrared technology to assess an array of objective pupillary variables including size, constriction velocity, latency, and dilation velocity, which are normalized and standardized to compute the Neurological Pupil index (NPi).
Eye-Opener: Why Do Pupils Dilate in Response to Emotional States?
It
has been said that the eyes are windows to the soul. Research has at
least shown that the apertures of our eyes offer a glimpse into the mind
Eye movement during retrieval of emotional autobiographical memories.
Neuroevolution of Self-Interpretable Agents
Inattentional blindness is the psychological phenomenon that causes one to miss things in plain sight...
Pupillary response
Pupillary response is a physiological response that varies the size of the pupil, via the optic and oculomotor cranial nerve.
A constriction response (miosis),[1] is the narrowing of the pupil, which may be caused by scleral buckles or drugs such as opiates/opioids or anti hypertension medications. Constriction of the pupil occurs when the circular muscle, controlled by the parasympathetic nervous system (PSNS), contracts.
A dilation response (mydriasis), is the widening of the pupil and may be caused by adrenaline, anticholinergic agents or drugs such as MDMA, cocaine, amphetamines, dissociatives and some hallucinogenics. Dilation of the pupil occurs when the smooth cells of the radial muscle, controlled by the sympathetic nervous system (SNS), contract.
The responses can have a variety of causes, from an involuntary reflex reaction to exposure or inexposure to light—in low light conditions a dilated pupil lets more light into the eye—or it may indicate interest in the subject of attention, or sexual stimulation.[2] The pupils contract immediately before REM sleep begins.[3] A pupillary response can be intentionally conditioned as a Pavlovian response to some stimuli.[4]
The latency of pupillary response (the time in which it takes to occur) increases with age.[5] Use of central nervous system stimulant drugs and some hallucinogenic drugs can cause dilation of the pupil.[6]
In ophthalmology, intensive studies of pupillary response are conducted via videopupillometry.[7]
Anisocoria is the condition of one pupil being more dilated than the other.
The Meaning of Pupil Dilation
Scientists are using pupil measurements to study a wide range of psychological processes and to get a glimpse into the mind.
Outlooks on Three-Dimensional Printing for Ocular Biomaterials Research
Scientists Reverse the Aging Clock: Restore Age-Related Vision Loss Through Epigenetic Reprogramming
First hint that body’s ‘biological age’ can be reversed
Telemetry System
Telemetry systems are an alternative method of transmitting data from the rotating assembly to the stationary data acquisition system.
In mathematics, intersection theory is a branch of algebraic geometry, where subvarieties are intersected on an algebraic variety, and of algebraic topology, where intersections are computed within the cohomology ring. The theory for varieties is older, with roots in Bézout's theorem on curves and elimination theory. On the other hand, the topological theory more quickly reached a definitive form.
Mathematicians Explore Mirror Link Between Two Geometric Worlds
A magnetic flow meter (mag meter, electromagnetic flow meter) is a transducer that measures fluid flow by the voltage induced across the liquid by its flow through a magnetic field. A magnetic field is applied to the metering tube, which results in a potential difference proportional to the flow velocity perpendicular to the flux lines. The physical principle at work is electromagnetic induction. The magnetic flow meter requires a conducting fluid, for example, water that contains ions, and an electrical insulating pipe surface, for example, a rubber-lined steel tube.
If the magnetic field direction were constant, electrochemical and other effects at the electrodes would make the potential difference
difficult to distinguish from the fluid flow induced potential difference. To mitigate this in modern magnetic flowmeters, the magnetic field
is constantly reversed, cancelling out the electrochemical potential
difference, which does not change direction with the magnetic field.
This however prevents the use of permanent magnets for magnetic flowmeters.
Ergodic theory
Mean ergodic theorem
Reynolds number calculation
Flowchart
Software
Diagramming
Soil Conservation Service (SCS) (1935)
Magmeter Basics
The main advantages of magmeters are the obstructionless design, linear signal output, corrosion-resistant wetted parts and high accuracy.
See also
Venturi effect
Inside Louisiana's horrifying 'Cancer Alley,' an 85-mile stretch of pollution and environmental racism that's now dealing with some of the highest coronavirus death rates in the country
Welcome to “Cancer Alley,” Where Toxic Air Is About to Get Worse
Air quality has improved for decades across the U.S., but Louisiana is backsliding. Our analysis found that a crush of new industrial plants will increase concentrations of cancer-causing chemicals in predominantly black and poor communities.
Hydropower Program
To help position Federal hydropower to meet the Nation’s need for reliable and affordable renewable hydropower, the Bureau of Reclamation, U.S. Department of Energy's Water Power Technology Office and the U.S. Army Corps of Engineers signed a Federal Hydropower Generation Memorandum of Understanding (MOU) at Hoover Dam August 24, 2020.
SCHUBERT CALCULUS AND QUANTUM INFORMATION
ALLEN KNUTSON
["Schubert House, Fletcher Home"]
Young tableau
Schubert Calculus and the Grassmannian
Young diagram
Barycentric coordinate system
Simplex
Coxeter–Dynkin diagram
with Preon ( point particles, conceived of as sub-components of quarks, and leptons) time magnetic moment
(consider) lattice space Perovskite
quantum biological process as unfolding per perinatal matrices
Dyck Language
Devil's staircase as the Cantor function, a singular function in mathematics
Evolution Runs Faster on Short Timescales
Narayana number
Triangular number
Trigrams are a special case of the n-gram, where n is 3
Bagua
Sierpiński triangle, Sierpiński gasket or Sierpiński sieve
The valknut as Borromean rings
Crystal structure of molecular Borromean rings reported by Stoddart et al. (Science 2004)[13]
A quantum-mechanical analog of Borromean rings is called a halo state or an Efimov state (the existence of such states was predicted by physicist Vitaly Efimov, in 1970).
Meiosis
Comparison to mitosis
Nano memory resistors
Role for Telomere Cap Structure in Meiosis
Prophase
Remembering the Perez Orchestra
Dissecting the telomere–inner nuclear membrane interface formed in meiosis
List of RNA structure prediction software
Pseudoknot
A pseudoknot is a nucleic acid secondary structure containing at least two stem-loop structures in which half of one stem is intercalated between the two halves of another stem. The pseudoknot was first recognized in the turnip yellow mosaic virus in 1982.[2] Pseudoknots fold into knot-shaped three-dimensional conformations but are not true topological knots.
Prediction and identification
The structural configuration of pseudoknots does not lend itself well to bio-computational detection due to its context-sensitivity or “overlapping” nature. The base pairing in pseudoknots is not well nested; that is, base pairs occur that "overlap" one another in sequence position. This makes the presence of pseudoknots in RNA sequences more difficult to predict by the standard method of dynamic programming, which use a recursive scoring system to identify paired stems and consequently, most cannot detect non-nested base pairs. The newer method of stochastic context-free grammars suffers from the same problem. Thus, popular secondary structure prediction methods like Mfold and Pfold will not predict pseudoknot structures present in a query sequence; they will only identify the more stable of the two pseudoknot stems.
It is possible to identify a limited class of pseudoknots using dynamic programming, but these methods are not exhaustive and scale worse as a function of sequence length than non-pseudoknotted algorithms.[3][4] The general problem of predicting lowest free energy structures with pseudoknots has been shown to be NP-complete.
Knots and Quantum Theory
(quantum) strings, threads, knots and braid theory... quantum biological wastewater innovation at
How to batch items in golang pipeline stages using channels?
The Palmer-Bowlus flume, is a class of flumes commonly used to measure the flow of wastewater in sewer pipes and conduits. The Palmer-Bowlus flume has a u-shaped cross-section and was designed to be inserted into, or in line with, pipes and u-channels found in sanitary sewer applications.
As a long-throated flume, the point of measurement of the Palmer-Bowlus flume is anywhere upstream of the throat ramp greater than D/2 (D=flume size). Montana flume has a single, specified point of measurement in the contracting section at which the level is measured. Unlike most other flumes used for open channel flow measurement, the Palmer-Bowlus flume can be calibrated by theoretical analysisTurbulence
Heat and momentum transfer
consider research with
H Flume Materials
Weir
A weir /wɪər/ or low head dam is a barrier across the width of a river that alters the flow characteristics of water and usually results in a change in the height of the river level. They are also used to control the flow of water for outlets of lakes, ponds, and reservoirs. There are many weir designs, but commonly water flows freely over the top of the weir crest before cascading down to a lower level.
Over there, that is weir.
Hans Christian Ørsted
Honoring 85 Years of NRCS – A Brief History
Weir Nomenclature andClassification
Hydrometry — Open channel flow measurement using thin-plate weirs
Rectangular Contracted Weir
Joule–Thomson effect
Peer pressure
- "Pier Pressure" (Arrested Development), an episode of TV comedy series Arrested Development
- Pier Pressure (audio drama), a Doctor Who audio drama
- pier pressure retarded osmosis pitch
Pressure-retarded osmosis
Innovation
Why Wave Power Has Lagged Far Behind as Energy Source
Researchers have long contended that power from ocean waves could make a major contribution as a renewable energy source. But a host of challenges, including the difficulty of designing a device to capture the energy of waves, have stymied efforts to generate electricity from the sea.
Osmotic power, salinity gradient power or blue energy
Osmotic Power
Harnessing the Ocean's Energy
Collin Riccitelli
December 16, 2017
Desalination Concentrate Management and Valorization Methods
Antonio Santos Sánchez, Ângelo Paggi Matos, in Sustainable Desalination Handbook, 2018
Wave energy finally gets its day in the water off the Oregon coast
Oregon Wave Energy Testing Project Moves Forward
By Jes BurnsElectromagnetic induction
Magnetic flow meter
Mosaic, Self-Similarity Logic, and Biological Attraction principles
Three explanatory instruments in biologyPhosphorus
Diamidophosphate
Pyrosequencing
Chimeric RNA
The DNA strand of chimeric RNA/DNA oligonucleotides can direct gene repair/conversion activity in mammalian and plant cell-free extracts
FokI
Focus (geometry)
In geometry, focuses or foci (UK: /ˈfoʊkaɪ/, US: /ˈfoʊsaɪ/), singular focus, are special points with reference to which any of a variety of curves is constructed. For example, one or two foci can be used in defining conic sections, the four types of which are the circle, ellipse, parabola, and hyperbola. In addition, two foci are used to define the Cassini oval and the Cartesian oval, and more than two foci are used in defining an n-ellipse.
Fluxon
In physics, a fluxon is a quantum of electromagnetic flux. The term may have any of several related meanings.
An analyte, component (in clinical chemistry), or chemical species is a substance or chemical constituent that is of interest in an analytical procedure.
Magnetic immunoassay (MIA) is a novel type of diagnostic immunoassay using magnetic beads as labels in lieu of conventional enzymes (ELISA), radioisotopes (RIA) or fluorescent moieties (fluorescent immunoassays) to detect a specified analyte.
Bio-MEMS is an abbreviation for biomedical (or biological) microelectromechanical systems. Bio-MEMS have considerable overlap, and is sometimes considered synonymous, with lab-on-a-chip (LOC) and micro total analysis systems (μTAS). Bio-MEMS is typically more focused on mechanical parts and microfabrication technologies made suitable for biological applications. On the other hand, lab-on-a-chip is concerned with miniaturization and integration of laboratory processes and experiments into single (often microfluidic)
chips. In this definition, lab-on-a-chip devices do not strictly have
biological applications, although most do or are amenable to be adapted
for biological purposes. Similarly, micro total analysis systems may not
have biological applications in mind, and are usually dedicated to chemical analysis.
A broad definition for bio-MEMS can be used to refer to the science and
technology of operating at the microscale for biological and biomedical
applications, which may or may not include any electronic or mechanical
functions.[2] The interdisciplinary nature of bio-MEMS combines material sciences, clinical sciences, medicine, surgery, electrical engineering, mechanical engineering, optical engineering, chemical engineering, and biomedical engineering.[2] Some of its major applications include genomics, proteomics, molecular diagnostics, point-of-care diagnostics, tissue engineering, single cell analysis and implantable microdevices.
Perinatal matrices or basic perinatal matrices, in pre-perinatal and transpersonal psychology, is a theoretical model of describing the state of awareness before and during birth.
Stanislav "Stan" Grof
is a Czech psychiatrist, one of the founders
of the field of transpersonal psychology and a researcher into the use
of non-ordinary states of consciousness for purposes of exploring,
healing, and obtaining growth and insights into the human psyche.
Holotropic Breathwork
Grof's Basic Perinatal Matrices, summarized in his own words
BPM I:
The biological basis of this matrix is the experience of the original
symbiotic unity of the fetus with the [mother].... Archetypal images
from the collective unconscious that can be selectively reached in this
state involve the heavens or paradises of different cultures of the
world. The experience of the first matrix also involves elements of
cosmic unity or mystical union.
BPM II:
This experiential pattern is related to the very onset of biological
delivery....the original equilibrium of the intrauterine existence is
disturbed....Very characteristic for this stage is the experience of a
three-dimensional spiral, funnel, or whirlpool, sucking the subject
relentlessly towards its center....The corresponding mythological theme
seems to be the beginning of the hero's journey....Agonizing feelings of
metaphysical loneliness, helplessness, inferiority, existential
despair, and guilt are standard constituents of this matrix.
BPM III:
Many important aspects of this complex experiential matrix can be
understood from its association with the second clinical stage of
biological delivery....This involves an enormous struggle for survival,
crushing mechanical pressure, and often a high degree of anoxia and
suffocation....[Themes of BPM III include the] titanic fight,
sadomasochistic experiences, intense sexual arousal, demonic episodes,
scatalogical involvement, and encounter with fire. All these occur in
the context of a determined death-rebirth struggle....Related archetypal
themes are images of the Last Judgement, the extraordinary feats of
superheroes, and mythological battles of cosmic proportions involving
demons and angels or gods and Titans....[BPM III experiences] combine
sex with death, danger, biological material, aggression,
self-destructive impulses, physical pain, and spirituality.
BPM IV:
This perinatal matrix is meaningfully related to the third clinical
stage of delivery, the actual birth of the child. In this final stage,
the agonizing process of the birth struggle comes to an end....The
symbolic counterpart of this final stage of delivery is the
death-rebirth experience....The transition from BPM III to BPM IV
involves a sense of annihilation on all imaginable levels--physical
destruction, emotional debacle, intellectual defeat, ultimate moral
failure, and absolute damnation of transcendental proportions.This
experience of "ego death" seems to entail an instant merciless
destruction all previous reference points in the life of the
individual....[after which]The subject experiences a deep sense of
spiritual liberation, redemption, and salvation.
Book by Mark B. Ryan Krishanu Roychowdhury,1, 2D. Zeb Rocklin,1, 3and Michael J. Lawler1, 2,
Sheri YinJune 3, 2009
No Matter How You Spin It: Long-Term Information Storage Technique Makes Spintronics More Feasible
Projecting the spin of an electron onto an atomic nucleus allows for much longer storage and recall of spin-encoded information
Spin–orbit interaction
Spin magnetic moment of the electron
Game theory is the study of mathematical models of strategic
interaction among rational decision-makers. It has applications in all
fields of social science, as well as in logic, systems science and
computer science
Spin valve
Spin-torque measured up
Evgeny Y. Tsymbal University of Nebraska at Lincoln, tsymbal@unl.edu O. N. Mryasov Seagate Research, Pittsburgh, PA Patrick R. LeClair Francis Bitter Magnet Laboratory, Massachusetts Institute of Technology, Cambridge, MA
Spin the Klein Bottle
FreeNode
Piezo-phototronic effect and its applications in flexible optoelectronic and energy technologies
- View ORCID ProfilePhoebe Tengdin1,*,
- View ORCID ProfileChristian Gentry1,
- View ORCID ProfileAdam Blonsky1,
- Dmitriy Zusin1,
- View ORCID ProfileMichael Gerrity1,
- View ORCID ProfileLukas Hellbrück2,
- View ORCID ProfileMoritz Hofherr2,
- Justin Shaw3,
- Yaroslav Kvashnin4,
- Erna K. Delczeg-Czirjak4,
- View ORCID ProfileMonika Arora3,
- Hans Nembach1,3,
- View ORCID ProfileTom J. Silva3,
- View ORCID ProfileStefan Mathias5,
- View ORCID ProfileMartin Aeschlimann2,
- View ORCID ProfileHenry C. Kapteyn1,
- View ORCID ProfileDanny Thonig4,6,
- View ORCID ProfileKonstantinos Koumpouras7,
- Olle Eriksson4,6 and
- Margaret M. Murnane1
See all authors and affiliations
Transmission coefficient
Landauer formula
A generalization of the Landauer formula for multiple probes is the Landauer–Büttiker formula
18 Characteristics of Codependents and 9 Truths to Support Recovery
Trump moved cyber security budget to pay for his wall before major hacking assault
‘We have a president diverting money, billions of it, to build a wall,’ says former FBI deputy
Codependency
is usually rooted during childhood. The child grows up in a home where
their emotions are ignored or punished because the parent (or parents)
suffer from mental illness, addiction, or other issues. This emotional
neglect results in a child having low self-esteem, lack of self-worth,
and shame.
Some common characteristics of dysfunctional families
In general, a learned behavior is one that an organism develops as a result of experience. Learned behaviors contrast with innate behaviors, which are genetically hardwired and can be performed without any prior experience or training. Of course, some behaviors have both learned and innate elements.
8 Signs You May Have a Codependent Parent
Neglect is a form of abuse where the perpetrator, who is
responsible for caring for someone who is unable to care for themselves,
fails to do so. It can be a result of carelessness, indifference, or
unwillingness and abuse.Augustine, in his Enchiridion, wrote: For what is that which we call evil but the absence of good? ... For evil has no positive nature; but the loss of good has received the name “evil.” Through Augustine, this doctrine influenced much of Catholic thought on the subject of evil.
Lessons for a Young Scientist
CityLab Daily: The Case for Rooms
Also today: It’s electric moped time, and the economic toll of New York’s inaccessible subway.Harry StutzCorporal Harry Stutz, a Jewish-American Soldier, had the idea to throw a Christmas party for the Wiltz children, and enlisted 22-year old Corporal Richard Brookins, a fellow soldier, cryptographer, and his roommate, to serve as St. Nicholas.American St. Nicolas
Wiltz, Luxembourg
The Holocaust in Luxembourg
Being a Go-Getter Is No Fun
Bonhoeffer timeleine
By The Associated Press
Houston's Texas Children's Hospital Plans Austin Expansion With Outpatient Care Sites
Dell Children's Medical Center of Central Texas officials were
surprised by move, but Houston chief says it'll be 'symbiotic
relationship.
Dr. Scott Collins is an accomplished innovator, repeat entrepreneur and
leader with 25 years of expertise spanning engineering, life sciences,
biodevices, IT, startups and strategy. This includes 15 years of proven
leadership experience spanning all aspects of forming, growing and
selling a technology company and 16 years of experience specifically in
life sciences. He led technology development for TeVido BioDevices, sits
on the founding board of BioAustin and the Scientific Advisory Board
for the New Organ Prize, an X Prize-like award for advancements in
vascular engineering. Scott earned a PhD in Biomedical Engineering with a
portfolio in Nanotechnology from the University of Texas at Austin
where his research focused on growing blood vessels out of the body and
utilizing adult stem cells to enhance the process. He has developed 3D
bioprinting and biofabrication techniques used in forming thick
vascularized tissues. He has a wealth of experience in business
formation, strategic planning, negotiations, programming, robotics,
cardiac signal analysis, bioprinting and biofabrication. He is currently
looking into new ways of applying technology to solve human problems.
researching nucleic pseudoknots as well mathematical strings, knots, braids, and mathematical surgery for innovations of Bio MeMs.
Who is most likely to be infected with influenza?
The same CID studyexternal icon
found that children are most likely to get sick from flu and that
people 65 and older are least likely to get sick from influenza. Median
incidence values (or attack rate) by age group were 9.3% for children
0-17 years, 8.8% for adults 18-64 years, and 3.9% for adults 65 years
and older. This means that children younger than 18 are more than twice
as likely to develop a symptomatic flu infection than adults 65 and
older.
Key Facts About Influenza (Flu)
Mosaic, Self-Similarity Logic, and Biological Attraction principles
Phosphorus
Diamidophosphate
Pyrosequencing
Chimeric RNA
The DNA strand of chimeric RNA/DNA oligonucleotides can direct gene repair/conversion activity in mammalian and plant cell-free extracts
FokI
Focus (geometry)
Fluxon
In physics, a fluxon is a quantum of electromagnetic flux. The term may have any of several related meanings.Grof's Basic Perinatal Matrices, summarized in his own words
BPM I:
The biological basis of this matrix is the experience of the original symbiotic unity of the fetus with the [mother].... Archetypal images from the collective unconscious that can be selectively reached in this state involve the heavens or paradises of different cultures of the world. The experience of the first matrix also involves elements of cosmic unity or mystical union.
This experiential pattern is related to the very onset of biological delivery....the original equilibrium of the intrauterine existence is disturbed....Very characteristic for this stage is the experience of a three-dimensional spiral, funnel, or whirlpool, sucking the subject relentlessly towards its center....The corresponding mythological theme seems to be the beginning of the hero's journey....Agonizing feelings of metaphysical loneliness, helplessness, inferiority, existential despair, and guilt are standard constituents of this matrix.
Many important aspects of this complex experiential matrix can be understood from its association with the second clinical stage of biological delivery....This involves an enormous struggle for survival, crushing mechanical pressure, and often a high degree of anoxia and suffocation....[Themes of BPM III include the] titanic fight, sadomasochistic experiences, intense sexual arousal, demonic episodes, scatalogical involvement, and encounter with fire. All these occur in the context of a determined death-rebirth struggle....Related archetypal themes are images of the Last Judgement, the extraordinary feats of superheroes, and mythological battles of cosmic proportions involving demons and angels or gods and Titans....[BPM III experiences] combine sex with death, danger, biological material, aggression, self-destructive impulses, physical pain, and spirituality.
This perinatal matrix is meaningfully related to the third clinical stage of delivery, the actual birth of the child. In this final stage, the agonizing process of the birth struggle comes to an end....The symbolic counterpart of this final stage of delivery is the death-rebirth experience....The transition from BPM III to BPM IV involves a sense of annihilation on all imaginable levels--physical destruction, emotional debacle, intellectual defeat, ultimate moral failure, and absolute damnation of transcendental proportions.This experience of "ego death" seems to entail an instant merciless destruction all previous reference points in the life of the individual....[after which]The subject experiences a deep sense of spiritual liberation, redemption, and salvation.
No Matter How You Spin It: Long-Term Information Storage Technique Makes Spintronics More Feasible
Spin–orbit interaction
Spin magnetic moment of the electron
Spin valve
Spin-torque measured up
Piezo-phototronic effect and its applications in flexible optoelectronic and energy technologies
- View ORCID ProfilePhoebe Tengdin1,*,
- View ORCID ProfileChristian Gentry1,
- View ORCID ProfileAdam Blonsky1,
- Dmitriy Zusin1,
- View ORCID ProfileMichael Gerrity1,
- View ORCID ProfileLukas Hellbrück2,
- View ORCID ProfileMoritz Hofherr2,
- Justin Shaw3,
- Yaroslav Kvashnin4,
- Erna K. Delczeg-Czirjak4,
- View ORCID ProfileMonika Arora3,
- Hans Nembach1,3,
- View ORCID ProfileTom J. Silva3,
- View ORCID ProfileStefan Mathias5,
- View ORCID ProfileMartin Aeschlimann2,
- View ORCID ProfileHenry C. Kapteyn1,
- View ORCID ProfileDanny Thonig4,6,
- View ORCID ProfileKonstantinos Koumpouras7,
- Olle Eriksson4,6 and
- Margaret M. Murnane1
See all authors and affiliations
Transmission coefficient
Landauer formula
A generalization of the Landauer formula for multiple probes is the Landauer–Büttiker formula18 Characteristics of Codependents and 9 Truths to Support Recovery
Trump moved cyber security budget to pay for his wall before major hacking assault
‘We have a president diverting money, billions of it, to build a wall,’ says former FBI deputy
Codependency is usually rooted during childhood. The child grows up in a home where their emotions are ignored or punished because the parent (or parents) suffer from mental illness, addiction, or other issues. This emotional neglect results in a child having low self-esteem, lack of self-worth, and shame.
Some common characteristics of dysfunctional families
In general, a learned behavior is one that an organism develops as a result of experience. Learned behaviors contrast with innate behaviors, which are genetically hardwired and can be performed without any prior experience or training. Of course, some behaviors have both learned and innate elements.
8 Signs You May Have a Codependent Parent
Lessons for a Young Scientist
CityLab Daily: The Case for Rooms
American St. Nicolas
Wiltz, Luxembourg
The Holocaust in Luxembourg
Being a Go-Getter Is No Fun
Bonhoeffer timeleineHouston's Texas Children's Hospital Plans Austin Expansion With Outpatient Care Sites
Dell Children's Medical Center of Central Texas officials were surprised by move, but Houston chief says it'll be 'symbiotic relationship.
Who is most likely to be infected with influenza?
The same CID studyexternal icon found that children are most likely to get sick from flu and that people 65 and older are least likely to get sick from influenza. Median incidence values (or attack rate) by age group were 9.3% for children 0-17 years, 8.8% for adults 18-64 years, and 3.9% for adults 65 years and older. This means that children younger than 18 are more than twice as likely to develop a symptomatic flu infection than adults 65 and older.
Key Facts About Influenza (Flu)
Reservoir Site Protection Study
Report 370
July 2008Texas Water Development Board
www.twdb.state.tx.us
Gilbert E. Kretzschmar, P.E., Samuel K. Vaugh, P.E., Robert B. Perkins, P.E., HDR Engineering, Inc. Robert J. Brandes, Ph.D., P.E., Richard D. Purkeypile, P.E., R.J. Brandes CompanyThomas C. Gooch, P.E., Simone F. Kiel, P.E., Freese and Nichols, Inc. Barney N. Austin, Ph.D., P.E., Texas Water Development Board
Hydraulics of side-channel weirs for regional detention basins
Austin, Texas
SECTION 4 - INLETS
Cipolletti (Trapezoidal) Weir
VENTURI METERS
Venturi Tube
Mechanics of Fluids
A.L. Stanford, J.M. Tanner, in Physics for Students of Science and Engineering, 1985
Comments
Post a Comment